Description :
From Genome Similarity Track
Location :
Scaffold_1:999984- 1001420
Transcript NameFunction/comments
Physo_3451242OG-Fe(II) oxygenase superfamily protein

Sequence
1436 bases(100 bases per row)
CAACTCGGTTTTCAGCTTCACTATCTCAGTAGTAATAGAACGTAAGGAAGTGTCCTAACTTTCCTAATTAGGACTGATAGGACAGCTATCTTAAATTACC
GTTACCGTCATTTATGGGAGTATCATTTAGGACTGTTATAGTACAGATAATCCGACACCCTATTACTGCAAGCGCTTACACGAAAATAGCCTCAAATTTT
GACTTGCATCCTAACGCTCGAGTTTATGAGTTAGCCACGTCGATCGGGCCGTTGATCTTGAAGTCTCCAATTTGGTTCTCCTTCCCCAGATCGGCGTAGT
TGCCCCGAGCCCTCGCCAGAATGTACTCCGCCCAGCTGAACGGACGGTAGTTGGGCACGTCCCCTTCCTTCACGATGATAGGCTCCACTTGGGCATTGTA
CGCTGGGAAGTAAAAGAACGGGGCCGAGAAGCGACTGGCCTTGTCCGTCGCCAGAACGCGGTGAATTGGGGCCACGAACTTGTCGTTCGACCACACCTGC
GTCATGTCGCCAAGGTTGATGGTGTACGTCCCCTTCCTCGGCGGCACATTCACCCACGTCTGCGACTTCCGGTGAAACACCTGGAGTGAAGCCACTTCGT
CATCTTGCAGGAGAATGGTAAGAGCGCCAGGATCCGTGTGGTTGTAGACCCCCATGGTCTTCTCCGGGTCGGGGGCCACAGGGTAGTGGTTCAGTCTCAT
GACACTGGGGCTGTTGCCCAGGAAGAACTGGTCGAAGAACGCGGGCTGTTCCCCCAACGACACCGCCAGTATCTTCAACAGTCGGCGGGAGATGTACTCC
ATCTTGTCGTAGTAAGTCTGCATTTCATGGCGGAACCCCGGTAGAATATCCTCCTGTAGCCACTGGTTCTGCGACGTGCCCAGTCGTCCGTCCCCCTCTG
GAGGTGGGGGGCCATCCTCGTAGGCCCCAGTGAAGTCGAAGCACTCCTTCCAGTCCGTCTTGTTCTTGGTGAGTTCCCCCTCGACATACCCGCGCGCGTT
CGTAGCGACGCGGGGGATGGAGCGCTTCGTCTCTGGCGGGAGACGGAAGAACGCGCGCATGAACTCCTGGAACCTCTTGACGTCTTGCGCTGGTAGGCCG
TGGTTCGCAACGTAGAAGAACCCCCACTCGCTCGCAGCAGCGGAGACCTCGTCGATGATCTGGCGGATGGACGAGTTGTTGGTGTCTCGAAGCGCCGCGT
CCACCTCTGCGTCCGTCGCGAGAGCCGTGAAGGCCCCAATGTCGATCACAGGGACCTGGTGCACCTCCATCTTTGGCTTGAGGAGGAGAATTCCGGAATG
AAGAACTGTGATTGGTTTCGATCCTGAAAGGACGTGGTGTGCGTTACGTACATGACTCGGATCGGGCAGTTTTGTTCTCTATTCGTTCTCCGGTAGAACA
CGATTCAACACTACTGTAAGCTTAGTTTTATTTCCT