Description :
From Genome Similarity Track
Location :
Scaffold_111:99983- 103275
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14067Hypothetical protein

Sequence
2515 bases(100 bases per row)
GCGCGAATGGTCGATTGCAGCAGGCGATGCAGGACCACGACCAACTGCAAGCGGCGGCGCCACCTCTGGTACCAACGTGGGTTGGTACTGTATGCATTTT
GGGACGCCATTGTACCACACGGCTGCGTGCCAGCCACGTGCTTGGGTGCGGGGCAATCAAGAACAGAAAGCACGTGCCGTCAAGTGAGTCAAGGTGAGGT
GATTGCAAATGGAGCCAGACGGCGCCGCAATACAGTCATGTCTTTGCATGGATTTGAACAGCAGTCGATTCCAGGCATATTGTGTTTAGTAGCCGATATT
TAGATCCAGTACACGTACATACGTACACGACATGTACTGCTGCCCATCTCTCGTCATTCTTGGGTGGTCGCGGGACGACAATAATATGTAATAGTCGATG
GAGAGGCTGGTAAAAATGCTTCCTTTTTGATTAGTGCACACGCGAGTCATCACGGCAACGTCGTGCGAGCGTGCAGTGCCACTGCCGGCAAGTGCAATCT
CGCAACCGAGAGTCACGGCGCGCGAGTATACGTCATGTGCAATGAAGCGACAGGCACCAGCGGCCACTGCGTTTGGCACATTGTGACGCGCGACGACGCG
TCGGCATCGAAGAAGGCGTCGTCGACAGGCGACGGGGCATTGGCCCGGTGCACGCGCACTGTGTACAGTAATGTCTGACCATCTCGAGGCGCGATGTGGA
CCTCGGCGAGAAGGCACATGTTTGCATTGCGCTGCAAAAGATACAGCGCGAGCGTCACGTCTCCGTGCGGCCCCACGTACCCGACGTAGTCGACAACGAG
GTCGGCCAAGCACGACTCGCCGGTCGGGAGCACGCGCAGGCTGCGGGGGCTGGCGTCGCACACAAACTCGGAGGGCACGGTACTGAACCGAGGCGACATG
GACCGCATCTAGTAGACACCATCGAGTATGAGATACGACGAGAGCAACCTCGTTGGTCTACATGCAGCGTTGGCGTCGAGAAGCGCTGCTGGAACGACGA
CATGTTGTCGAGAAAGCAGAGGTAGTGTACGAGGGACGTTGAGAGCGCCCAGTGGTGCACGACGGTGGCTTCTTGTTGCCACACCCACGTGCCATCCACA
GCGCTGCCGGCGCTTGGGCTGCGGAAGCGCGTCGGCGCCAGCGTCTGTGTCTATGCAATATCGCGTGAGGGGGTAGGGTAGGGGTGGGGCAAAAAACGGT
ACCAAAATGTACGACTCGCGCATCTGCGCCACAAACCGGCCAAAGAAATGGTGGTCGTTGCTCTTGGTGTGGTGTGGCAGCGCGCTCGCAACCTCGACTG
CCGAGACGTGGTGCTGATCCAGCACCGCCTCCAGGATCGGAAAGAGCACTTGCTCCATGAGGCACTCGTAGTAGACGCGCTGGAGGTCGGTCTTGTCGAG
GACCGCGGCGGCGTTGGCAACCAAGACGTCGTTCATGCGCTCGAAGACATCCTTGTGGTTCAGCGCGACGATCATGGCGAGGCACACGTCGTCGTGGGCA
GTGCTACCATGCCCCACGACGCGACGGGCAAAGGTGCGGTACGTGGACGCGGAGCCACTCGAGGAGCGGCGGTGGCGTCGCCTCCAACGAGATGGACTGC
AGACTCGACAAGATGGCCATCAAGTGGTCCGAGCTCGTGCTGGGCGGCGCAAAGTCTTGGATCTGGAGCTGTTCTCGCTCTTCTTGTTGTGCTCGCCGCG
GTACGACACGATCGTAAACGGCGTTGACGCAACCGACGCAATGAGGACCCCACTCGTTGTCGTTGGACGGCGCGGCTTCAAAAGACGTACGCCTACGCAG
TGAGTTAGTCGATACGAGCAGCGCACGTACTATTAGTAGTACCCGAAGCACGTGGGGAAGGTCCCGCTGGGCCTTGCTGCGGCCGCTCTTCCATGCATAG
TGCCAGCCATCGACGAGTTTTTCGTCAAAGCGAAAATGCCGCACGGTGTCGAGCGACGGCAGCCGGAGGCCTTCGTAGAGCGTGCCAAATATATTGGACC
GCGACCGGGTGTGGGCCTCAAAGTAGCTACTAGGGACCACGTCGTGCAGCGCAAAGACGTCGTCGGTTGCGGTCGTGAACGCGAGCACAGCACGCAACGA
CGCGAGTTGGGACCGCGGCTGCACCGCCAGGCAAATGGCCGTTCCACAGTTCCGGTAGTGGATGTGGTGGGGGCAGCAGTGCGGAAAGCAGCGCAGAATC
TACGACATTGCTTTAGTTCCCGTTTGCCTGTAATACAGCATGTCGTGAACCTTTTGGCCTTGGGATTTCTGGCATCTAATAGTCCAAGTGCAATGTGAGG
TGCAATCTCAATCCAGTCGTGTGGGATGGCCGCGTACCGCACATACGTGGGCTGGAAGAGCGCGCCGTGGGTGCACTCGGGGAGGTAAAAGGCGCAGGAC
ATGGCCGATTGAGAAATAGTACGAGTGCCAACTTGACCACGCGCGGATGACGCGCCGCCCGAATGTCATTACTGCATCGGAAAATGCTTTTCCAGTCACG
TGCGTGGAACCTACG