Description :
From Genome Similarity Track
Location :
Scaffold_245:99975- 102352
Sequence
2377 bases(100 bases per row)
CCGCTAGAATCCGTTCTTCGATCTCATTGACGAATTCAAGGATGTTTTCCCCGACGACGTTCCCTGTCACTACCCGTCGACAAGGGTGTACGCCACGAAA
TTGACCTCGTGCCCGGCACGAAGTATTGCGTTACTCGCCAATGGCCGCTTCCACGTGATCAAGTCAAAGCGATCAACACCTTCTTTGCGGCTCGTATAGC
CGCCGGTCATGTACGCGAATGCACGTCCCCACACAGCAGCCTGACATTCTGTGTGAAGAAACCTAACGGCAAATGGCGGATTGTTCACGCCTTTAACAAG
CTCAACGCCGCGATCATTCCGGCGCAAGCACCGATCCCCCGCATCGATGTAATTACCGACGACGGCATGGGTCGATCAACTATATTCTCGATCATCGATC
TTCGCGATGGATTCTATCAAATTATCATGTGCCTTTGTGACGTGCCAAAGACCGCCGTCTCGATACCAAGTGGAATGCTTTGGAAATGGCTCGTGATGCC
CCAAGGCATATCCAATGGCCCTGCGACCTTCAATCGCATGGTGACGGCCAAGTTCCGCCCGCTTCGCGACTTTTCCCCGTCCTGCCTTGACGACATCTAC
ATCCATAGTCGCGGTTCTGCAACCGAGACCGACGTCGAACTCACCGTTGGCATCATCGTGCGGTTCTTACCGTCCTTCGTGAGAATGGCTTGTACGCCAA
CCTCTCCAAATGTCTGTGGGAGTCGATGAAATCCCTGTCCTTGGAGACCTCGTCGGCATTCGTGGTTGTCGGGCTGATCCTGACAAAGTAGACCATCATC
GACTGGCCAGTCCCCTCCTCGGTTAAGTACCTTCGCCGATGGCTTGGCTTAGCTTGGCTACTTACCTCCACAAGTACTCTCGTGGTTTTGCTGACATCGC
GCAACCCATCTTACGGTTGCTAGTCAAGGATTCCCCATGGGTTTGGTCGAGCAACTGTCAGTCCGCCTTTGACACCCTTAAATCTAGAGTCAAGAGCGCT
CCAATTTTGGCGCTCCCTGACTTTTCCAAGCCGTTCAGCGTCGTGTATGACGCCACCCAATTTGCCATCGGTTTTTGCTTAATGCAACCTGACGCTGTTG
GTCTCTGGCGCCTTGTATCCTTCAAAGTCGCCAGCTCCAGGCCGCCGAGCGTTCGTACCCCGTACGCGATCTCGAACTCCTTTCGATCAAATACGCCCTC
ACCAAGTTCCGCGTCTACCTCATCGGCGCGGACCCCTTCGTCGTGTACATCGACCACGCGTCATTGCGAACTGCCGTCAACACCCCACACATGTCAGCCC
GCATGGCTCGCTGGCTTTCCTTCTTCGCCGAATACAACTTCTCGGTTCAATACAAACCAGGCAAGGACAAAGTTTTGACTGACGCTCTCTCTCGGCGTCC
AGGGTACTCCTCGCCAGTGGACCTTGCCTCGATCGGATTCCTCCACGCCGATTTCCATGACCGCATCCGCGCTGCCTATTCCTTCGACACGACCTGCTCG
GCCGTGTCAGTGTCCTCACCACCCCCGAGCCGCTCAAGCCTCGGCGATCACCGTGCTTACTCCATCGATACTCTGTTCCAGATGGCCTGCTCTACTTCCA
GCCCACCCAGGACACATCTCCGCACATTGTTGTCCCTGGGGATTCTGCGATTCGTGCCTCTCTTCTGCGCGCGTATCATGTCCCACTGGTGGCCATTTCG
TCCGCGACAAAATGTACGCTGCGTTGTCCCGTTGGTATTGGTAGCCTCGCCAATACAAAGCTGTTGCCCGCCATGTCGCTGGTTGTGACTCTTGTCAACG
CACCAAGGTCGCGTCTTCCTCGCAGGCGCCACTATAACCTTTACCGATACCTGATGAGCTCTGGTCATCGGTCATCATGGACTTTATGTTTGGTCTCCCG
CGTGACGCTCATGGTCACTCAGGTATCATGGTTTGCGTCGAGAGGGCGTCCAAGTGCATCACGGCCGTCCCTGTCAAGGAGTGCATCAGCGGCGATGATG
CCGCTCGCCTTTTCTATGATCATGTCTTCTATCGCTTTGGACTCCCGCGGTTCATCATATCAGACCGCGATCCCCGTTTCACCTCCTACTTTTGGTCGGC
TCTGTTCGAGCTCTGTGGCAACAACCTTGCCATGTCTACGACTGACCATCCCGAGTCGGATGGTCAGACCGAACGTGCCAACCGCGCGCTTGAGGATATT
TTACGCGCGTACTCCGTGAAACAACCTTCTGCCTCGTGGGCCACGCACCTCCTCCACGTCGTCGTTGCGTACAACAAGCCCAGGCTTCCACCGGCGTCTT
ACCCCACTATGCTGTCCACTTACAGCACCCTCGTACCCCTCAACTCCTCTACAGTCCCGTTTCAGGGGGGAGAAGCT