Description :
From Genome Similarity Track
Location :
Scaffold_245:99964- 102173
Sequence
2209 bases(100 bases per row)
TAGGCCTCCCTCCGCTAGAATCCGTTCTTCGATCTCATTGACGAATTCAAGGATGTTTTCCCCGACGACGTTCCCTGTCACTACCCGTCGACAAGGGTGT
ACGCCACGAAATTGACCTCGTGCCCGGCACGAAGTATTGCGTTACTCGCCAATGGCCGCTTCCACGTGATCAAGTCAAAGCGATCAACACCTTCTTTGCG
GCTCGTATAGCCGCCGGTCATGTACGCGAATGCACGTCCCCACACAGCAGCCTGACATTCTGTGTGAAGAAACCTAACGGCAAATGGCGGATTGTTCACG
CCTTTAACAAGCTCAACGCCGCGATCATTCCGGCGCAAGCACCGATCCCCCGCATCGATGTAATTACCGACGACGGCATGGGTCGATCAACTATATTCTC
GATCATCGATCTTCGCGATGGATTCTATCAAATTATCATGTGCCTTTGTGACGTGCCAAAGACCGCCGTCTCGATACCAAGTGGAATGCTTTGGAAATGG
CTCGTGATGCCCCAAGGCATATCCAATGGCCCTGCGACCTTCAATCGCATGGTGACGGCCAAGTTCCGCCCGCTTCGCGACTTTTCCCCGTCCTGCCTTG
ACGACATCTACATCCATAGTCGCGGTTCTGCAACCGAGACCGACGTCGAACTCACCGTTGGCATCATCGTGCGGTTCTTACCGTCCTTCGTGAGAATGGC
TTGTACGCCAACCTCTCCAAATGTCTGTGGGAGTCGATGAAATCCCTGTCCTTGGAGACCTCGTCGGCATTCGTGGTTGTCGGGCTGATCCTGACAAAGT
AGACCATCATCGACTGGCCAGTCCCCTCCTCGGTTAAGTACCTTCGCCGATGGCTTGGCTTAGCTTGGCTACTTACCTCCACAAGTACTCTCGTGGTTTT
GCTGACATCGCGCAACCCATCTTACGGTTGCTAGTCAAGGATTCCCCATGGGTTTGGTCGAGCAACTGTCAGTCCGCCTTTGACACCCTTAAATCTAGAG
TCAAGAGCGCTCCAATTTTGGCGCTCCCTGACTTTTCCAAGCCGTTCAGCGTCGTGTATGACGCCACCCAATTTGCCATCGGTTTTTGCTTAATGCAACC
TGACGCTGTTGGTCTCTGGCGCCTTGTATCCTTCAAAGTCGCCAGCTCCAGGCCGCCGAGCGTTCGTACCCCGTACGCGATCTCGAACTCCTTTCGATCA
AATACGCCCTCACCAAGTTCCGCGTCTACCTCATCGGCGCGGACCCCTTCGTCGTGTACATCGACCACGCGTCATTGCGAACTGCCGTCAACACCCCACA
CATGTCAGCCCGCATGGCTCGCTGGCTTTCCTTCTTCGCCGAATACAACTTCTCGGTTCAATACAAACCAGGCAAGGACAAAGTTTTGACTGACGCTCTC
TCTCGGCGTCCAGGGTACTCCTCGCCAGTGGACCTTGCCTCGATCGGATTCCTCCACGCCGATTTCCATGACCGCATCCGCGCTGCCTATTCCTTCGACA
CGACCTGCTCGGCCGTGTCAGTGTCCTCACCACCCCCGAGCCGCTCAAGCCTCGGCGATCACCGTGCTTACTCCATCGATACTCTGTTCCAGATGGCCTG
CTCTACTTCCAGCCCACCCAGGACACATCTCCGCACATTGTTGTCCCTGGGGATTCTGCGATTCGTGCCTCTCTTCTGCGCGCGTATCATGTCCCACTGG
TGGCCATTTCGTCCGCGACAAAATGTACGCTGCGTTGTCCCGTTGGTATTGGTAGCCTCGCCAATACAAAGCTGTTGCCCGCCATGTCGCTGGTTGTGAC
TCTTGTCAACGCACCAAGGTCGCGTCTTCCTCGCAGGCGCCACTATAACCTTTACCGATACCTGATGAGCTCTGGTCATCGGTCATCATGGACTTTATGT
TTGGTCTCCCGCGTGACGCTCATGGTCACTCAGGTATCATGGTTTGCGTCGAGAGGGCGTCCAAGTGCATCACGGCCGTCCCTGTCAAGGAGTGCATCAG
CGGCGATGATGCCGCTCGCCTTTTCTATGATCATGTCTTCTATCGCTTTGGACTCCCGCGGTTCATCATATCAGACCGCGATCCCCGTTTCACCTCCTAC
TTTTGGTCGGCTCTGTTCGAGCTCTGTGGCAACAACCTTGCCATGTCTACGACTGACCATCCCGAGTCGGATGGTCAGACCGAACGTGCCAACCGCGCGC
TTGAGGATA