Description :
From Genome Similarity Track
Location :
Scaffold_7:99941- 104363
Transcript NameFunction/comments
g5780.t1ETK75233.1 hypothetical protein L915_18116 [Phytophthora parasitica
g5781.t1XP_009518077.1 hypothetical protein PHYSODRAFT_295452 [Phytophthora sojae

Sequence
4422 bases(100 bases per row)
CGCTTAGGCCCCCAGCGGCTCGGCCTCGACCTCTTCCTCGCTCTTGACGTCGCCCTTGGCCGCGAGCTGGGACGGCTCGTGGTCGTCGCACTGCGCGACC
CACTTGCTCTTGACCGGCATGATGTGGCAGTTGATGCGCATGACCTTCAGCCCCTTCGTGACCTCCAGGTCCACCTGCGTCCAGTTGTTGCGCTGGTCGG
GCATGGTGCAGATGTGGCCCACCTTGGGCTGGCCGCAGCGGCCGCACTTGTACAGCTTCCGGTTCGCGTCGTCGAGAGCCATCTTCTTGCTGGCCGATGA
GGAGGCAGAGGTGCTCACACTGCGACGCGGCGGCGAGCGGCCCGGATTGAGGTCTGCGGGACTCGGCTCCTCCGGAACCGAGAGGAAGCCTAGATTCATC
TGGGACATATCCACCGATAGCCCCGACGAGCGGTTCGGACCGCGCCTGCGAGCGGCTGCGCGGGGCGGCAAGTTGCTTCCTAACGACGAGCGTCGGCCGT
GCAGCGAGTGCACCGCCCCGCTGGCAATCTGAGGCGGCACCTGGAACTGGAACTGCTGCATGTTGGGCTGTGGTGGCGCCGGGAACATGGTCGGGTCCTG
GAAGCTGGCGAACGGGTTGGGGTACCCTTGGTTCGGGTTCATGTTCTGCTGCTGAGCCGACTGCATCTGTTGCTCCTTGGTTTGCTGCGCCAAAATGCGG
AACTGGTCCAGATTGTGAAGCAGGTCCACAGGGTTCGAGTGGTGCCTCGAGTGGTGGTTCACGGGGCGCTTCCGCTTCATCTTGAGCTCATTTACTCCCT
CTTGGATGCGCTGCGAGCGGTAGGCGACGGGGGACGCGCCCCCATTAGTTCCGCCATTGTCGTCCGTCGTCGCTGCGTTCACCACCGGTACCTGTTGCTG
CTGCTGGTCGGGGTTTAGCTCCGACCACGATAGTTCCTTGAGGAACTCATCCATTTCTTGGAACGACTCTCCCTGAGGCGTCGCGGAACCCGTGAACGGC
ATGGGGTTGGTGATCGGGGATTCCCCATGGACAGGTGCAAAAGGCATCATGTGTTGTTGCTGGGGAAAGCCCATACCGTTGGGCCCCATGACAGGCGTGG
AGATGACGCTGGGAGCCATGTTGGCCATGCCGAAGGCCTGCAGCACGTCCGGATTGGAACGCACGCGCTTGTGTTTGTGCTGCGGCGCCACGCGGTAGTT
GGCCCCCACGGCCGTCGAACCGTTCGGGTTGAAGGAGAAGGAGAGTGGCGTGAGCAGGTCGTCGCTCTCGGCCTTGGGCGCCATCATGTTGGTGGGCGAT
GAGCCGGGCACGTCGCTGTCCAGCAGCATTTGGTCGTCGGGCGCCACGAAGCCGGCGGGCGCGTTCACAGAGCCGTCAGCGGGCGCGTCTCCTCCCTCGA
GGAAGTTGTAGTCGAGCGGCAAGCCGTCGAACAGGTCCAGCGTCTGCGCGTCTGCCATGGGGACCGGTTGGGAGAATTCTGCTATAGAGGTCGAAGCTCT
TGTGAGTTCGGTGCGTGCAAATCGAGTTTGGAAGGGACTGGTGCGACAAATTCATGCAGCCTCGGATTGGTCAAAACTCTCTAAACCCTAGCCCTAATCT
ACCAGCTGCCGCCTTGATTCAAAATGGCTACATTATGCAAGCGGCGGCGTCGCAACCGCACTGCAACGGCTTGACGTGTTTGCACGCATCACGTTTGCCG
CTCAAGACGCTGTTAACAAACACTTTCTTAATACTTTCTTCATACATATTATCCACGTGGGGAGGACGCGCGGTTACCCCTCGCTACAGGCTACAGAGTG
TGCGGGAACGCCATGGTCGGCGTGCCGCCGCCGAAGCTCGAGACGCCCATCTCGTACGTCACGGTCTCCGCCGGATGGTGCTCCACCGTCTGATAAAAGG
TTGGGTCCAACGCGCCAGCCCGTGCAGGATCTTGCAACAACGCCTGCAACAACGCACGCGATCGGCCGAACGCAGTCAGCAACCAATTTTCAAGCCCAGA
TCGCCCTCAAGCCGGCGCCGCGCCAACGAAGCGATGCCATCCGTGTCAACTCCAGCAACAAACGTTCGACGCGGCGGCGGCCTTCTTAGAAAAGAAATTC
ACTCACCTGCAGACTCAGCGGGCTCAGCTGCGACGGATCCTGTCGCGGGTACGGGTCCCACATGCCCGCGCCGTTTGCGCCAGGCTGCTGAGACTGCTGG
CCTTGCTGATGCTGCTGCTGTTGCTGCTGGTTGTCGCCTATCCGGGACATAGCGTCAATCTCACCGTTCGCGGCGGGGACGGCGGCCGGGAGCCAGGCCT
CGCTCCCATTCTGCTGCTGGTCGGTCTGATGAACAGGAGACGCGCTTTGGCTTCCAGTGGACGTTTGGCGCTCGTAGTATCGTGGGTCATAACCATTGTT
GGTCGCGTACTCCTGACCCTCATACTGCTGGGGTGGGGCGTAAGGCTGCTGAGCGTAGGCAGCGGCGGCATACAAATTCGGGTCGCCGCTTGGAGAATGG
CCCATTAGCATGCCTCGGTTCTGTTGGTACGGCTCCGCCTTCAGGTCCTCCGTGAGCATGGCGACGTGGCTAATGTGTTGGCCCTGCTGCATCTGCGCCT
GCTGCTGCAAGAGTTTCTCGTGGAGACGCATTTGCTGCATTTGTTGTTGCTGATCAAGCTGCTGCACTGCTTCGGCGTTATGCGCTTGCAAGTGCTGCTG
CTGCTGCAGAAGTTGCATCTGTCGCTGCCGCATCAACGCCGAGTTGTTGTATCCTATGGCCGCCTGTTGTGCCGCCGCAGCTTGCGCTTGCTGTTGGTTC
TTCTTATGCTGTGCGTGTGAAGCCGCAGCCTTGCTCGGGTTCTGTTTCAGCGACTTCCACCGGATCTTCACCGAGTCCTCCGTACGACCCTTCAGAAGCT
GAGAAATCTGCGACCACTTGTTGCCGAGCCGTGCTTGGGCGGTGAGGATCACCGAATCCTCCTCTTCAGTGTAAGGGCCCTTATTAATGGCTGGATCCAG
GTGGTTCTTCCATCGTTCACGGCACTGCTTGGGCGTACGTCCTGGGATACGCTCAGCGATCTGGCCCCAGTTGTTGCAGCCTTGGGTCACCAGATACTCG
AGCACTTGGTCCTCTTCGAACGACCAGTGCCCCTTCACCAAGCCCGGCTTTAGCACCTTGCGCCAACGCTGAAGGCACTGAGCGTGATTGCGCCCAGGGA
CCAGCTCAGCAATAGCCTTCCAGTTCTTTTCGCCGTGGATACGCACGCTCTCACGGAGAGCCGAGTCTTGACCCTTCGTCCAGCGCTTGGTCGTCGGAGC
ATCCGGGTCTTCCCCCAGCTCAGTGTTTCCATTTGAGTTTTCTGCGTTCTCTTCATTAGCTGCCACCGGCGTTCCTGCATCGGAGCGGGTGCGCTGCGTG
GGCTTCTGCTCGCCTTGGACAAGCGTGCGGCTACTCTGCGGACGGTCACGCTTTGCTGCAGACACGTCGTCGTCCTGTGTCGAGAATGTCGCACTGTTGT
CTCCCGGGATAAAGCCCTTCTTGTTGATTTCCAACTCGCGCAGGTTCAACTCCGAGTCTGCAATGTGCGAGTTGCTCAGCAGACGTCCCACCTGCGAGAT
ATCTTCCTTGGAGATCACCACCGATGACGAGGACAACGAGCGTCCAACGACAACACCGTCGGCGTTGGGCATGCCCGCTAGGTGCTGGGCCGTTAGCTTA
TGCCCATCAGCCTCTTTGCTGGAAATTGCACAAAACGTAGAGCAGTTAGCGCAATTAACACAGACAATAGTTGCACTAGGATGTCGTACCCATCGGGGCC
CACCACGGCATTGAACGAGTGGAACTTGTTGGCGCCGCCGTTGAGCATCTTGACGCGGCTGGCAGCTGCAGAGAGAGAGCAAAACGTTAGCATCAAAATC
ATGGAAAGAAAAATGATCTGGCTGAGCGCACCGTTGAGTGCCTGCTTGCGCTTGAGGTGCGACTCCATGTTGTGCTCCTCCTGGGCCTGCACCTCGGCCA
GCTTGGCCTGCTGCACGAGGAACTTTTTGCGTAGATTCAGGATGAACTTCTTCTTGCCCTCGACGGTAGACTCGGCCATGGCTTTGATCACGCGGAACTG
CTTCTCGTCCCGCAGGCGGCCCACGTAGCGGCACAACTCGCCACTCTCGCTCGGGGACAACCCGCTGAGCGACATGAGGAAAAGCCGCGAGGCCTCGGCA
GGCAGCGACTGCAGCAGCTGCGCCAACAAGTCTCCAAAGTTGTCGGTCGCCGCCGATTCCGTGGGCGGCGCCGGCTCCGGCTGGTTGTCGATGGCCGTGT
CCGCCATGCTTGGGCCGTGTGCGTGTCGTAGAGAAGAGGGGCGGGTGCGCGCGCGGGCGAATATTGCCTTTTGTCTGCCAGCGGTCGTTCTCCCCCTTGT
CGCTGCGGTTTCCCCTTCCCCT