Description :
From Genome Similarity Track
Location :
Scaffold_607:9994- 13648
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_607-snap-gene-0.8P-type ATPase (P-ATPase) Superfamily

Sequence
3654 bases(100 bases per row)
NNNNNNNNNNNNNNCTACCTGGgAGGGACCCTTCTCAGTCGCTCGGACACGCTTGgTTTTGGTGGTTCAACTTTTAtCTTAGAATCGATGCTAGCACGTT
TATCCGGAGAGAATTGTGCGCcGATAAGCTGAATtGTGATTTGTCAaGTATGATACGTagCCATTTATACGTACCCGCCAGTCGGTCGAATTCGTCGCGC
GCTCACAATCACCATGATGATGGTCACTGGCTTGACAACTTGCCATTGGTGGCGTCTGCTCCATACAGTGTGGTTGTCACAGACAATAAAGCCCTCCGAA
TCCCACAGTGTTGTGCTGTCGGTACTGTAGGAGTAGCCCGCGTAGTAAACACACCAGATCTGCATGAAGAATCGTCGGCGTaGTAAAcTccccccTCAGT
GCACCcTCCCAGTCTCCCAAGTGGCCGACAGTATGTACTGTATTaCACACACTTGGATAATATCTGCATATCTTGGATATTCCCAGTTGTGTTGCCATGT
GCATAGACAGTCGACAGTGGGACTGCTAGGTTGCGGCAGCCCACGACGTTTCAAAAGTGAGGGTTCGCGATACAGAATGTTtGTCGTCCACCTACATTCT
TGATTGACCTCGGTGAGCGGATCGTGAACACTGGAGATGGGCAATGGCCCcAGGAATGGAATGGAACTCGGTTCTGTATGCACGCTTTACGGTCTATGGC
TACGGAAGCAGGCGCAGGAGCAGGCCCCAAGGAAGTGTCATCGCCGCCAGCCCcACGCACACGCCCcACTGTTCCACGCTCAGCGGTACGGCGTGGAAAa
GCTGACCACCATGCTGCACGGCGACGTACTGCAGGGCGGACTGGACCGCCCAGCCAACGAGGAACGCTCGGTTcTCCAGTATGCCTTCGAATACGTTGCG
CTCGTCGTCAATGCGACGGCAGTTGAGCTGGTTGAAGAGCTGCAGCAGCGCAAACGTGTTGAAGAGCATCGTCGAGCGCTCGGATGGCATCGTTGTGTCA
TCTGGGGCAGCGGAACTGGCGAGCGGCCAGTCGGCAGCCACGCGCGTCATGAGgAGAGCGAACTGCAGCGCACTTTGGCCCGCAATGTGCTTGCGCATCT
TACGTGAGAGTAAcGGAGAGTCGATGTGGTATgggaCTCGCCGCATGACGCGCTCGCTTGGCTTCTCCGTCGCGAGACCGATGCTCACAAACGCATCCAT
GAACAGATTGATCCATAAGATCTGCACAGCCGTAAGTGTTGATGCTTCGAAGAaCAGCGCCGTCacAACagCCATGGTCACAGCGACCAGGAtcATCGTG
AGTTGGAACTGTAGGAACTTAGCGATGGAATCGTACACGTTTcGACCCCACATAATGGCGTTGACGATCGAGAGGAAGTTGTCGTCAAGCACAACGATGT
CAGATGCACGCTTGGCAaTTTCAGTtCCGCCCTGGCCCatGGCAAACCCGACGTGTGCCTTCTTGAGCGCCGCAGCGTCGTTCGTGCCGTCACCAGTGAC
TGCAaCCAGCTGAGAACCGTGCTGACTACTCTGAGTTGCCATGAGGCCATTGACCAGCacGAGCTtATCCAgCGGGgTAGCACGTGCcAGCACACGAAGT
GTGGGCCATATGCGGTCAAACTCGTCCTGCTTGATACTCCCGTTGCTATCGGTGACACGATCGCGGAACTCGGTGGCATCCATCGCAGTAATGAGACCAT
CTTCGAGATGGTGATCGTCCGTGCCGAGAATCCCACACtGTTTTGCGATAGAAGTCGCTGTGAGAAGGTTaTCACCGGTCACGATGCAGACCGCAACGCC
CGCTGACTTGCACATTGCAATGGCACGAGGAACCTCAGGCCTGATGGGGTCTTCAATAGCCACAACaCCGAGAAACACCAAGTCGCTCTCGATTTGGGTT
TGAGAAGCGACACTGTCTGGATCAGTCGACTTGTACGCcAGgCAGAGTGTACGGCACCCACGCATCGCATGCCGCTGCACGACCGCAGAGAGAATGGCAT
CCTTATCTCTCGCGTCAAGCGACTGGATGTCTCCTCCAATTGCACGCTGTGCTGTACACATTCGTAGCACATTTTCTGGAGCTCCTTTGGTCAGGACGAG
CGTCTCATTGGCTTTGCGCTTCATGACAGTACTCATACACTTGCGATCACTGCGGAACGGGATCACCCGTACGATGTCGgCCTTGTCCCGCAGACTCTGG
TAGTCTTCACCAGCATCGCGAaCAAATCGAAGGAGCGCACTCTCCgTTGGGCTTCCGGTCGCACTGTCACCACGAAGCAGCTCAGCGCCTGAGTTGATGG
TCATACTGAGCATCAAGAGCTCTACTCCGTCTTTtGTGATCGACATCGTACTGTGAAGTCCAGTGGGGgATGTGATTTCCTCTCGTGatCtCCCCCAGCC
ACACTGCTGTGACGGTCATTTGGTTCGTCGTGAGTGTACCTGTCTTGTCAGAACAGATGATCGTGGCGTTCCCCGCCGTCTCGCATGCATATAGGTGACG
GACCAGACTCCGGtCTTTGAGCATTTGCCGCACCGAGTACGTTAACGCGATGATCACAGCCAGTGGCAGGCCTTCGGGGATCGCGACGACGAGAGTCGTG
ACTgcGAGGATGAAGAACTTGACGTACTCGCTCAGCGCTTCAGCCGACCACGGTTCATCGTCGAGTGCAAACTTCTTGATGgAGAATCGAATGCTCAGTG
CCACGAACAAGACGATCGATACAACGATGCCGATCTTGCCCATCAAGAGGTTCAGTCGTTCGAGCTTGAGTGCTAGTGGTGTTCGATCTAAAGCGGTCTC
TTCGTCACTTTTCTTGTCTTCACCCATCTCGAGAGGTTCTCGTCCTTGAGACGACTTGGGCGTAGCGATGGCGACGTATCCATCAGGCTCTTTCGTCTTA
CTCaCCTTCGGCTTGCCGTTCACAACACCCATGATAATGCCTTCTTGAGTGTGCTCGCCTACGCAAAGCACGACCATCGAGCCacTGCCTTCCATCACCG
TTGTGCCACCtAGCacAACGTTGCGCTTCTCGTTGTCCCATTGCTTGCTCACGGGTTCAGCTTCCCCAGTCATTGCACTCTCGTCCACACGGAGTTCCTG
GCTGGACAAGAGCAGACCATCAGCTGGGACTACGTCGCCCGTGTGCAAAACAACGACATCCCCCACGACGATGTCCCATTTCCGGATCTCTTGCGGCGTG
CCGCCATCACGTACGACATGCACCAATGGGTTGTTCTTAACAGCATTGAGCTCCTGAAACTGGTGCTCTTTCTTGAACTCGGTCAGTGCCGTGACAAGCA
CAaTAGCCGCGACAGCCACGAGGACGCATGTGCCTTCGACCCAGTCAGTCGACGGATGCGACCCCACCGAGACGCCGAGCACAAGCGACACGAGTCCCGC
ACCAAGCAGCATGAGGTTCGTACGGTCAAGGAAAGCCGCCTCGAGCATAAGGCGGCCAAGCGACTTCAACGCTGGTGGCTCGACGACGTTGCGGCCGAAC
CAAGCTGCCCGTGCGGCCAAGGAATCGGACGCCACACCAGCAGCGATGCGGTCAGAAGACGCGAGGCCGAGCGCACGCGCCAGGCCaCGCCATCCTTCCA
ATGCATCCAACACGGGCCTGGCCTTCGCAATAGAGACAATGCGGGCGAGCTGCT