Description :
From Genome Similarity Track
Location :
Scaffold_423:9990- 11283
Sequence
1293 bases(100 bases per row)
GCGGGACAGTTTTGAGCTCGGAGAACAGCGCTTTGGTACAAACGCTGCTTGAGCGCACATGTTGCTGATAATGGTGAGTGAATGATTGATAGGCAACGTC
ATGTTGCTAGGTAGACGTCGAGGCGTTGAAGTTCTGTGTGGCAATGACAATGATTGGATGAGAGTTTTCTGGTACCGATTGAGGAAATATACGTAATGAG
TATTAAGTTATGCCTGGCAAAACGttcttcattctgcaatCCACTGTGGCGAAGGAACATGTCAGCGGTGCAAGATTAAGCAGAAAGAGAGGAAGTATCT
TTTGAGTGCGTGGCGCTCAGAGATGAGAACGGATCCTTCTCATTGACGATAAAGAAGCGAAAAACGTGGGACGACTTGATGATGGCTGTCAAAATCGAGC
TAGGCTGTAAGTGTCCTGCAAATCAACTTAAGTTTTGGTTTGCCACGATCAAGATCGAGGGTAGCAGCACCCAGTGGCTTCCATCCAACACAGACGCTGT
AAGGGGTCTCCAGCGGGGGGAGATTCACGCAGACATTAAGACTTTGATCAAGATAGAGCAAAAGTTCGAGAAAACACAGACAACTGGGGCCTTGTTGAAG
GAAACGAAGTTGGACGACCCCGCATCGGATCGGATCCATGTATTGGTCAAGGCCCCACCTGGGGCGCTGCAGGATACAACACCTTCGCGAGAGGGTGTGT
TAATACCCTGCATCAATCCATTTTTCTCGCAGTTTCTATCGGGCAAAGAAGCTGATAGTTGGCTTGAATTTTCGTCCGTGCTGCCTCTGACTGAACGACA
GACGTTCTACGTTCTACGTCCGTACTTCGTACAAAGTGATCGCTGAGCAAGCATTGGCTACCGTGAACCCAAGTCGTCGGAAGTATGTTGCTGTCACTGG
CACCCCTGGCATCGGAAAGTCAATATTTGTCTTCTACGTGCTGTGGAAACTCATCAAGGAAAAGAAGCGGGTGCTGATGTTTATGCCTGGTAGCACATCG
ATATACTATGATGGAGACAAGTTATGGCATGCCTGCAACTGGCTGATCCCAATAACCTCAGTTTTTGGACGCAGCAATTGTGGTGTCTATTGGACTCCAT
AAATCCAAGTAGCAAGACGGGTCTTCCCTGTTGGGATTGCTCTATTCTTCTGGTAAATACACAACGAGGCTACGTGAAGGAATTTGTGAAACTAAATCCC
AAACCTGAAGTGTATTAGATGCCTCTGTGGACAATGGATGAATTGAAAGCCGTCTCGTGGTTATATGATGTGGATCAAAGCGTGTTGGAAAGC