Description :
From Genome Similarity Track
Location :
Scaffold_472:999- 5144
Transcript NameFunction/comments
Physo_145089reverse transcriptase
Physo_145090hypothetical protein

Sequence
4145 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCAAACCGTTCGTGGTCT
ACACAGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTTCGGGT
TGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGAATACGCCACGACTGACGCCGACGTCAATGCCATTGACGCCATG
CGATCGAGCGCCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGTGCCTT
CTGACAAAGCCCGTCAGAAGCTACCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAA
CGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAG
ACACACCTTCTTCTCACACGAGACTTCTACTGGGCCCACCAGTATAAATGGGTACGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAATGTGTGAAGCCTG
CGCCTTTCGTGAGGCTCCCTTGCAGTCACTACCGACTCCACGGGAGTGTTGGCAGTCCGTGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAG
GGGAACACGGGCATTGTGGTCTTTGTTGACCGCTTCAGTAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGT
TCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACT
TCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTAC
TGACACGATGGGATTGGGGATTTTCGAGGATTCCCCGAGCCGCGCCTGTGATTGGTTGGCTCAGAGGCTCACTATGGGAGAGGGAGGCAGTGACACGTGG
CGTATGGGAAAAGCGGATCCCGGCTGGACTCGCGTTGGCAGTGTACAAGGTTTGGTGACCCCGGATGGAGACGTCCCCAAGAGCGGACCCCGGCTGGAAC
CAAGTACCGAACGAGAGGCAAAGCCCAAGGGAGCGTAGAAGTGCCTCCGACTGGAGGCCGCCTGTTCTTGGTGCACTGTACAACGCACGAGGAGCCCGAC
CGGATCGAGTGAAGACCCAGAAACCGTGAAGCTGTCCAAGACATCCCGGATGTGAAGCCCAAGTGGAGTGTGATCCCGTTTGGAGATAATCATGAATCCC
GGATGGAGATACCAAGATACCAAGATACCATCCCAGATGTGAAGATCCAGTATACAAAGTCCAAGATGTTTCCGACCGACCAAGCCGACCAGCCAAGATC
TGTTCGGATTCCGTGGAACATTGAACTTCGCTTGCGTACCCAGTGATGATTATACTTGCTGGAAGTATGCTACGAGGGACCGCGGACGATTACGACGACA
AGACCATAGTGAAGACAAGTCAAGATGGAGTGCATGTAAAGATCGACAGTAGATAGCCAGACAGAGAGAGAGACCACAGATAACAGATAAACAGAGTTCG
TTTTGCGAAGGATCGCGCAAGTGAGTTGGAGCAGCCTACCGGACGTGCATTCCCGGAGGACCGACTAAGTCTACGTGTGAGGGCCCAGCAACTGTGACAT
CTGGGTCGAGCTCCCGCAACAGAGTCCAGTCCAAGTTGGGGTGAGTACCGGGCGACAACCCGAGGTTGATCCATCCCATTTCATTTCCTAGTTGCGGTTG
AGCTCGTCCAGACCAGGAAGGCCCCGCATTTCATATTACCGATTACCTTGTCACCCCGGTTGGAGTAGCCCCGGGTGGGAAGTATTGATTTAAGAGCTGT
TGTGTGATAGGAGGTATTTGATTGTGTTAGTTTACCTCAGTACTTGAGGGTGGTGCGCGTGAGCCTAGCCGTCCGGGATTGACCACTATCCCGGAGTCCG
GCTGGAGTTGACTGGAGTAGTGACCGACCCTTTCACGGTCCAAAAGAATAAGGAAGGGCTACGTGTTTGTATATAACTCTGTATCTGTTTGTATTGTTTG
GTTATCTGAGGGCTGTCAGAGGCGACGTCCAGGAAGGTTACGTTCTGTCCTGCTACCTAGCGACCTACAAGTATCAAGACAACTCATCCACGGTTGAAGA
CCCCTGGTTACGAAGACAAACGAACCCACAGCGATTGTTCACAAGGACACACGCCACCCCAGTTGGAGTGTACATCTCGGTGTACTATCTCCGGCTAGGG
TTTGTTCTGGGTGCACCCCATTCGGGAGTCTACACCCGGGACGCGCTAAAGCTATACACCGGGGCGGTCAGGCGTTCACCCGCCTCGCCTCACTACGCTC
ACTCGTTCCAACACTGGAGCGAGTGTCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGC
CATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCT
GACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAAGAAGAAGCACGCGTCTGTGCAGGGCACAGACGCCGAAAAGAGCAAGAAGAAGAAGAAGA
ACGGGTCTGTACAGGGTACAGACACTCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACT
TCGTGCAGTGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAACGTTGGTAGGGGCAA
CACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAATCAAAACCTGCCTAAACATTCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCT
TCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCATCTTGCATGCGCCTCCATCCGACCTTTTACGTCGGGCAGCT
GAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGGGGAAGCCCCAGCGGGAGCAAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCA
AGCGCGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCCTGAGCAACTTGAGCTCTCAGGGTCGCCATCTGCTGCTTCAGAGC
GGCGAAATCCCGGCTCTGATGCTGCTCCACAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACC
ACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAACCGGTTCGT
TATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN