Description :
From Genome Similarity Track
Location :
Scaffold_3312:999- 2573
Sequence
1574 bases(100 bases per row)
AGAAGGGATGACGGTTGAAGGAGAGTCGCAATGCTTGGATCCAAGGGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGAT
CTACACGCAGAGGATCTTGGGGAAGGCATGGCGGTGATCCCGGAGGTACCACGGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGG
CGAACGAACCCAAGGAAGTGGATCGTCTACGTCAGAAGATCTGGGAAAGTCGACATCTGCTGATCGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGG
AGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTGTCGGATCTGATTAAG
GGCCTGCTGCAAGCCAAGATCATCAGCTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCA
TTGATTACCGGCTATCTAACAGCCTGACTCGATTGATGGTGTATCTGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTG
CTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAAC
CGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTG
GATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGA
CATTCTAATCCCGGCGAATTCGTGGGATCAGTTGTGCGAAAGAGTGACATCTCTACTGGAGGCGTGTACTAAGTGGAATCTTTCTATCAGTGTGGTAAAG
AGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTCCGTTAGCCGATTTGC
CCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTTGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTA
TGAATTGAGAGAGGTAGATTTCGCCGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGAGAGATATCGGATCCACAAAGGAAT
CCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGCCAACAGAGAGAGGATCCAGGTTGGATAGAGACGACGGATCAGAA
CATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATTCTCCGTCATTTCGATCCA
GAACGTCAACCTACGGTTATAGTTAATGCCAGCGACTGGGCAGACTCAGCAGCTCTAATACAAGAACATGAGGG