Description :
From Genome Similarity Track
Location :
Scaffold_794:9989- 13804
Transcript NameFunction/comments
Phyta_totarag10750ABC transporter lipid exporter ABCA1 family

Sequence
3815 bases(100 bases per row)
ACGCTGGATGTTAATCCCAACATTGAACGGGTGAGCGCAGAGCTTCGAGAGCAGGAACGTCAAGGTGAAGCACTAGTAGTGCAACGACTGCGCAAGGTTT
TCGCTGTCCCTGGCGGAGAAAAGGTTGCTGTCCAAGGGCTCAACAACACCATGTACAAGGACCAGATCACGTGCTTGCTTGGCCACAACGGTGCTGGCAA
GACCACATTAATCTTGATGCTCACTGGGATGACCGCACCGTCCGGTGGTAACGCCACGTACCGTGGTTTGTCCGTGAACGAGGACATGGACGAACTGCGT
CAGTCGGTAGGTATTTGTTTCCAGCACGACGTACTGTTTCCCGATCTCTCCGTGGAGGAGCATCTGCTGTTCTTCGGTCAAATTAAGGGGTACGCGAACC
AGGAACTGTTGTCCATGGCTGAGAAGCAGATCCGTGAAGTCGGCTTGACTGAGAAGCGCCACTCGAGACCCAACGATCTGTCTGGTGGTATGAAGCGCAA
GTTATCCGTGGCTGTCTCTCTGCTGGGGGATAGTTCACTGGTGTTCCTCGACGAACCGATCTCTGGCATGGACCCTTACAGCCGTCGTAGCACGTGGGAG
ATCCTGCTGAACAACCGCAGTGACCGCGTCATGGTGTTGACGACGCACTTCATGGACGAGGCCGACATTCTTGGTGACCGCATCGCCATCATGGCGGAGG
GCGAGCTGCGTTGCTGCGGTTCGTCGTTGTTCCTGAAGAACCGCTTCGGAGCAGGGTACAATTTGACTCTCGTgaaggacgacgccaagtgCGACGACAA
AGCTGTGTCCGCCTTCGTGACGTCGTTTGTGCCGTCTGCGCAGCTCCTGAGCAATGTCGGCAGCGAGATTGCGTTCCAGTTGCCGCTCCATAGCTCGGCG
CAGTTTGCAACGATGTTCGCCGAGTTGGACCGTCAATTGCAGACGCTGGGTCTCTTGTCGTACGGCGTATCGGTGACCACGCTGGAAGAAGTGTTCATTA
AGTTGGCGGAGTTGGGCGATGAGAACCACCAGCACACGTTTGGCAACAACGTACGTACGAACAGCTCGGAGTCGAGCGACTATCAGCCATGCGACGAGAT
CATTACGTCCACCCCAATGTTTAGCACACACCTCCGTGCGCTGCTATTGAAGCGGTTCCAATACGCCAGACGCGACAAGAAAACGATTATCTACAGCGCG
CTACTGCCAGTGCTGctcattgctgctggactgGGGATACTGAAGGGCAGTGCTCTTGCCTCGGACAATCCGATCATGGCGCTGACAACGGATGCGTACT
CCGGCAGTGAAACCCCGACGCCGTATTTCTGCCAGACTAGCCGCGACGCAGGAGAATGGTGCAGCGAGGTGATGGCACTGACTTTCTTCTCTGGTGCTGA
TGTACAGACGCTCTCGATTTCAAAGCCAGCGTTTGACTCCGAATCGCCCGCCGTGTTTGACGTGACCTACACGGATCCAACCATCAATGCAAGTGGAGCT
ACCGGCTACAGCGTCGCGATTGGCCAACAGCTTTACAACCGCGGATATGGCAAGGGCGCTGATCTTGTGGAGGGCCAATATGGTGCCTACTTGGTCTCCG
GCGACAGCGACCAGAATTTGTTCGGCTACAACGTGTTCACGAATACGACAGCGCCCCACTCGTCGGCGATTTTCAAGGCGTTGATGGACCAGGCTTTATA
CCGCTTCTTTGCAGCCAACAGCTCGAGTGACTCAGTGGATGCATCCGTGGACCTGAAGGTGAACAACTACCCACTACCGGTCACAGCCGCCACGAAGGCG
TTTTCCGGGTCAGCAGTCGCGTTTGTAGCGTGTATGTTCATCTGCATCGCATTCACCTTCCTGCCGGCGTCCAtcgtggtcttcttggtgaaggagaagc
agacGGAGCACAACtcgaagcaccagcagcttgtctCGGGCGTGTCCCTACCTGCATTCTGGGTCTCGAACTACGTCTGGGATCTGGTCATGTACGTCGT
TCCATGCGTGTGCGCACTCGCCTTGATATACGCCTTCAACGTGTCTTCAATGACCGGTCAGGACTGCAATAGCTGCACAGCCGCGAAGTTCCCAGCAGTG
ATTCTCTTGTTTATCCTCTTTGGACTCGCGATTTGCCCGTTCACGTACTGCCTGTCGTTCCGCTTCAAGGAGCATGCGGCTGCGCAGACGTACACGATCA
TGATCAACTTCGTCATTGGCGTCGTACTGATGATTGTGTCGTTCATCATGAGTGTACTCGACTCGACGTCCGCTGCCGATTCTGTGCATGTTTTCATTTG
GCGTCTTTCTCCGCTCTTCAACCTCGGCACGGGCTTGCTCCAGTTGGTTGTCAGCGACATCATGTACACTCGCTTCGCtaaggacgagaaggtcaGCCCG
TTCAGCGGTGACATTATGGGCTTCGAGTTGGCGTATTTGCTAGTGACCGCTATTGCGTACATGGCACTAGCGGTGTACCTGGATTACTCGAAGACCTTCC
CGAAGGTGAAGAACGACGCTGAGGACATCGATGATAGTGGGCTTGAGATCGATGCTGATGTAGAGAAGGAAGCTCAACGTGTTGCTAGCGGCGGcgcaga
tggagacgctATCAAGCTCATGGGACTTCGCAAGGTCTATCCGGGTGGCAAGGTGGCCGTCCGCGATCTGTCCTTCGGCTTGAAGTGTGGCGAGTGCTTC
GGCTTCCTGGGAATCAACGGCGCTGGCAAAACCACCACCATGAAGATGTTGACCGGTGACGTTCCTCCAAGTCGCGGCTCGGCCACACTCGGAGGTTTCG
ACATTctgacgcagcagatcgaggtGCGCCGACAGATCGGGTACTGCGCGCAGTTCGACGCCTTATTTGACTTGCTGACTGTGCGCGAGCACCTGGAGCT
CTTCGGTGCTATGAAGGGCGTGCCGCAATCGTCACTGGATCGTGTCGTGACGGAGAAAATTCACCAGTTGAACCTCGCAGACTTCGAACACATGTTGGCT
GGTAGTTTGAGTGGCGGCAACAAGCGCAAATTGTCAGTGGCCATTGCCATGATCGGCAACCCGGCCATCATCTTCCTGGATGAACCGTCCACCGGTATGG
ACCCCGTGTCTCGCCGCTTCATGTGGGATGTCATTGCCGACATCTCCACCCGTGGCAAGGAATCGACCATTGTGCTTACGACGCACAGTATGGAGGAATG
CGAGGCACTGTGCTCGCGCGTGGGTATCATGGTGGGTGGCCGCCTTCGGTGCTACGGAAGTGTGCAGCACCTCAAGCCTCGGTTCGGTGATGGTCTGATG
TTCGATGTGAAGCTTGACACGCTGACCACGGAGGAACAGGAGTACCTACCGCAGCATGTCTTCGGCGATGGCAACACCTACGTGACATCCATGGAGCTAG
AGAGTAAGTGCCACGCGTTCGGCAACATTGAGCTGGCGGGGCGTATCACAGCTTCGCATCCGACTGGTTACAGTCTTGCCGCCGCTATGGAGCGCGACGG
ATTCATCCGCGCAGAGGCCTTCTGCTCTTGGTGTGTCGAGGAAACACACTTCGACACGTTGAACGATTATCTTGTCAACGCGTTAGGCCCGGACGGAGTG
CTAGTGATGGAGCGCCAGAACGACTTCTGCCGATTTAAGGTTCGCGGATCGAACAACGAAGTCAAGTTGTCCAAGATGTTTGCTCTGATTGAGGACGTGA
AGGCCGAGATGTACATTCGCGAGTACAGCGTTTCGCAGACGACGTTGGAGCAGATCTTCAACTCGTTCGCCAGccaacaggaagaagagaagggtGTTGC
ACGCGGTGTCTTCCA