Description :
From Genome Similarity Track
Location :
contig_64:99889- 102348
Transcript NameFunction/comments
g11544.t1hypothetical protein

Sequence
2459 bases(100 bases per row)
CGAACCACTTTATCATCTTGGTGTTCTGCGTCGTGGCTTCGAGTCTCGTATTCATCTTGGATGCCGAAGTGACGGTGTTGTCTGGTGTCTTCGCGCTCGC
GTTCCTCTGCGTGCTGCTGTCGTTCACGATTGCTTGTCTGCTACTGAAGATCGGCCGTGAAGAAATCCCGCGCAAAAGAACAACGTCGTGGTTCAACACT
TGCTTCTGCCTGGGTATGATCACGTTGGGAATTCTTGCGAATGCGTTCTCCGATATCAAGGCGCTGTCGTATTTCTTCATCTACTTCGCCGTCTTCTTCC
TGGTCGTGTTCCTGATGCTGACCCGCGTGAGTCTGCTCAAGGGATTACTCTACATTTCGCGCAAGCTGTTGCTGCACTTCCGAGGTCACAGTGAGTCAGT
ATCCATGCAGCAGCTCTCGGTTCAGGGCCAGGCTTTTGTCGGCAGTGTGAAGATTGCCAAGACGATCGAGACGATCAAGAACACGCCTGTGGTCTTCTTC
TGCAAGGTGGCCAACTTGCCCAAGATCAACGAGGCGGTGCGGTACGTGATGCAGAACGAGCACACGTACTGCCTGCGACTCGTTCACGTGTGCGAGCCGA
AGGCGCCTGTGCCGCGTGAGTTTGAGCACGTGGTGAACTTGTTTGACCACATTTACCCGTCGATCAAGATCGATTTCATCGCCGTGACGGGAGCGTTTGA
CCCGGCGATGGTGCAGTGGCTGTCGAAATCGATGGCTGTTCCTACGAACATGATGTTCATGCGTCAACCCGCTAACGAGAACATCCACCGCGTGTCGGCG
CTTGGCGTGCGTGTCATTACGGATTAGACGTTCACGAGTCTACTTCGGCTAGCGAGTGGACTTGCTAAGTTAAAGAGAGAGCTCGAGTTTGCTGTTTCGT
GTCAAGGATGATCGCACCGCTTTCCGGTATCCGGATACTGTACCTACATGTTCACGTACATGTACACGGATGGTTTGGAAATTGACTTTCGGTTCGCAGT
GGTAGACTGCCGCAATGATTGCCAGTTTGCGACAGGTACTGGTACAAAAGCTCACGTGTGATAGGCAGGCACTCTGCAATCATGGGATGTGACTCCGATT
AGCATGTCCGACTGCCAGTCGGCGACTGGGGAGTTGGTCATTGTCCATTTCTCCAGTTCAGACTGAGAGCGCAGTCGCCGCCGCGTCACTCTGCAGCGGC
ATGTCGTCGCCTCTTTTCATCTTGGCAGTGTTCCTCGCAATAACTGCAGCAGCTGAGCACCGCAACACGCTGCACAACTTGCAGAATGAGACGATGACAG
AATGGCCATCATTGCGCTTCCATTTCACCATCAAGCGCGACGCCATGCAAGTTCACGGCCACTCCGAGTTCTCTGTGCTGGCTAACCCTGTTGTGTCCAC
CAATGGCGATAACAGTGACAGCGTGCTGTACGACACCTTTGCTACGTTCGAGGAGGACTCGATGATGCACACCTACACACTCGTAGACGGTATCGCGTAC
GTCTCCGAGAGCTCTGTGGACGATATCAGCGTTGACCCTTTGGTGAAATGCGTGGAGTCAGGAGTTCTGATTCCAATCAACTCGATCGTGTTGGCACTCA
ACGAGGCTGTTCCTGTCTCGAGTATCTCATCGAAAAGTAGCGGAACCATCGAGTGTTCCAGTGGGAACACGTTCAAAGCCACAGTAAACGGTTTTGATCT
CGGATTGTGTTTCTCGGATTCTTCCGGATTCACGATGTATGGCAACGATATGAATATCGCCGTGGAGTATTTGGAGAGTCGTGAAGACATTGCCGCGCCA
ACGATCAAGAGTGACGTGAAGAATGAGTGCGAAAAAGTGGCGTCGGCTAGCTCAGTGACATCGATCGGGAGGTCATTTCTGACTGGGGCATCGATTTCTC
TCGAGGATACGAGAGAACTGCGAGCTGCGTTCGATTTCGATTTCTCGATTGGTGATGATGATACGTGCTCGTGCAAGTCTACGCCACGCCCATGCATCTT
TATCCACGGGTTAGGAATCCTCCAAGAGGCGCCGGAAAACCTGGACACGTTCCCTACCAAGTATTGGGGCAACTCGACCGTGACTGCTCATGCTCCATGC
TGCTCGTCAATTAAATTTGCGCTGCTGAATACGATGAATAACTCCTGGACGGACGATGCCCAGCAGCAGAAAGTGTGCGATCGAGTTCTTGCGGTTAGCG
AAACCAGTCAAGGAACTGCAATTTCAGACACCATCATCATCACGCACTCCATGGGCAATCTCATACTGGCTGGTGCAATTGCTTCAGGCAAGTGCAGCCT
TGACTCTAACGTGTCGTGGGTGGGCTTATCAGCGCCAATGCGGGGGAGTATGGCCTCCAACTACTTCCAGGATTCCTGCAAGAACGAGACGAACGCATAT
GTCGAAAAATTAGTGGCGAAGACCGGCTATTGCCCCGCAGACGACGGTATCATCTCTCT