Description :
From Genome Similarity Track
Location :
Scaffold_9:998711- 1006657
Sequence
7946 bases(100 bases per row)
ACTTCCTCTTGCGCAAGGTGCTGTGTGACCTCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTC
GTTGCCATGCATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGTC
TGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATCCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCC
GGCGGCGGAAGCAAATCCGCCTCACCCAAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGAGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAA
GTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACA
CTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCG
TTCGCGCTTCCTCGCGTGCAAACAAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTACTCAATGAACACATC
AAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGTCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCACCCTTGAAGAGGCGATTCAAGTGGCTC
TTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGCTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGT
TCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGC
AGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTAC
TGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGC
GGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGA
CGGTTGCTCGTAACAGCAACAAGATGTCCGAAGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCATTGT
CCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATTGATCCATATGATATGATTCTGGGC
ATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATG
TTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCAA
GGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGTCGGCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTC
ATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTG
TGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGG
CAGGCGTTGAATACGCTTCCTGTGTGGGTACAACAGTATCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAA
AGCTCCCCGTCACAGACGCCGTCGGCAAAGACACCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTTGCTTCAAGCGACTCGGAGTCC
AGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAAC
CGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGACCTGAG
ACCACTCAGGAGGAGCTGAACTCCTCCTCAGTCTTGGACGAGAACGTCCTGAAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCA
AGAACCCCGAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAGCAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCA
CGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAA
GCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGCTCACGCTTATA
ACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGAAAGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGA
TTTGGTAGACGGATACTACCAAACCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATG
CCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATAT
TCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGC
CAACATCGACGAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTCAGCAACGTGGGCGTTTGGGCTGACCCCGACAAGGTCAAGGCC
ATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCG
CTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAACAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGC
CCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCT
GGACAGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGAAGCTCCTGGCAATGAAATATGCCC
TTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCA
AAGGATTGCGAGGTGACTGTTCTTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTTGCGGACTCCCTCTCTCGGC
GTCCCGACTATGAGTTGGCCCCACATCACGCGGGTGACATCGGATCTATATGATCGGATACGCATGGCGTATCGGGACAAAAAGGCTGTCGCGCCTATCG
TCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTA
TTATCGGGTGGAGTCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGC
GGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTCAAGACATGCGAAA
CATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTTACTTCATCTT
TGGGCTTCCCGCCGACAAGCACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACG
GGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGT
TTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCT
CGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCC
ACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGG
CTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGG
GTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGT
TACTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCGACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACA
TGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCT
GACTCGCAGATCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGTCTCGGTCGGGACGGC
AAGGCTGCGGTCAAGACCGTACGTCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCG
TACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGTCTCGTCCAGATTGGACGAAGAGGCCC
GGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGC
AGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCATAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGA
GCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGCCCACTACCAC
GTGAAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTG
AACGGCTTCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACG
GTCGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGAGCAA
ACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCA
CGCCCAGAACATGTCCTCACAGGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGCGACCACCCCGGGTCTCGGGC
TTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTTGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCT
GAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTC
CTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCC
TGCTGCTGGTCGAGGTCATTCGAGACCACCCGGGGCTCAACGATAGCACCCTCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGA
TAAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTCGCGCCTTCGGATTTAGAGGC
CTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGA
CTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGGCGACAGCACGCTGCCTTCTTTGTGCTCACTGGGCACTGAGCTGTGCC
CTCCCACAGAGCCCGCAGGAGCATCCTGAGTGCTCTCGGACTCGGCATTGTCTTCACTGCCCGAGTTGAACTCGCGTTCTACGAACCGAGGGTTCGGACG
GTTGTCTGAAGACGAGGGTGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTA
GCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGTAG
TGCCATGAGGCATGTTAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCG
CGCGGCCACGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGATGAACACCTCTTCATTCAGATTGGTCGGTAAACCGAGCCTAAGTGGGGGGGGAT
GTAACAGGGTACGTAGCCCTAAGTGTACCCTGGCTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGAGATATTTGGTACAA
GGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTAACAGTTTGTATTAAACCCAAACTTAATCTACCTATAAA
TATACTCAGCTTACAATCTACCTTATTTGGGTCACTTCGCTCTCTTTAATAAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCG
GAAGATAACTTCCTCTTGCGCAAGGTGCTGCGTGACCCCGTCACAT