Description :
From Genome Similarity Track
Location :
Scaffold_43:9986- 11070
Transcript NameFunction/comments
Physo_136069hypothetical protein

Sequence
1084 bases(100 bases per row)
AACCGTGGCTGCTGCGACGAGCGCCACGATGTTCACGATCCCGGATCGTTTACTTTCCTGCGTGCACCGCGCTCGTGCATTTGTTCATCTCCATAGGCGC
TACACACCCGACACTAACGGATGGATGGGACGTTGAAGCTCCGCTAATAATGCTTGAGCCCAGCCACCTGTTGCTCCCCTTTCACCTTGGCCCAGGGTTT
TCGAGTGTTCTTATCCGTGGACAGCGGTCTTCAGGCTTAATAGATAGACTGCAGCGTCCTGGTCACTTATCGTTTGGCGACTCGCGAGAGTCGGAGACTA
TTGTCAGGCGCCAGCCACTCCACCACCGGAATGAAAGGTGTGACGCCGTTCGCCGCCGTCCACGTGACGCCGGACCAAGCGCGACGCTATGAGCGCCAAG
CGCGTCAGCTGCTGGACGACACGATCCGGGAGTTCGACGCGCACGTCGCCGCCTGCGGGAGCGGCAAGAACCCGCTGCACAACAAGTGGCAGTGGAAGCC
GCTCAAGACCCAGGAAGGTCTCAACGTGTACAAGGAGCGACAACCGACGCACCCGGAGCTCAACCCGCTCGCAACTCGCAGCACCAAGACTTCATCCATC
GACTCAGCGTCCAGGGGGAGCTCCACCACCAGCTCAACGACCGACAGAGTAGCGAAGCCAACGAAAGCCCTTGCGATGGCTGCGTACGCGCCGGAGATGG
CTACTTCTACGTCGTCCGCAGCAGTGCCCGGGGCCTCGTCGGTGGCCTCCGCGGTCATCACCGGGCGCATCGACGGCAGCTTGAACGACGCCATGTATGG
ACTCCATGCGACGGATTCGCCGGAGCTGCAGCTCCGCCTGCGTTACATGCCAGACGCGGAGGTGCTTGACACAGCCATGCTCAGCCTTATCCAGTCTCCT
ACTGCAGCCAGCCCCTTCCAGTTCATCGGCCTGCAGTGGGTCCTTCGCGGCGAGAAACCTGCTCGAGCCAAGTCAAGTTCGCGACGACCGCGAGACTTTG
TGGTTCTGGTGTCGTCGGGGTTTGTACAGCACAAAGTATCGGGCACTTCGGAGCCGCAGGAGATCGGCTACTACCTGTGCCAGT