Description :
From Genome Similarity Track
Location :
Scaffold_48:99855- 105320
Transcript NameFunction/comments
Phymu_g2638presenilin-like protein
Phymu_g2639hypothetical protein PHYSODRAFT_534487
Phymu_g2640hypothetical protein PHYSODRAFT_353225

Sequence
5465 bases(100 bases per row)
TCTCGTTTTTTTACTGATATTCTTATTGTAAAATTTGCAGTGGAGCGTATGGAtgcttttgcttcttctAGGCTTCTGGGACCTCTTTGCCGTCTTGACA
CCAGTGGGGCCTCTCCGTTGTCTCGTGGATCTCGTGCAGGAGAGAGGCACGCCAATTCCCGGTCTCCTGTTCGAAGCGGATGTGGAAGACGCTCATATTG
GCGAGAGTAACAGGATTCAGCAAAAGTCTACCGctcggaggagaagattTGCTACAAGAGAAACCGTTCGTGAAGAACCATTTATCCACCGTCTTCTACT
TGCAGAGGAGACTGATCATACACTTCAAGATCATCGTGCAGTAAACGCTGCGGAGTTTCGACGCCAAGTCCAAGCGTTTCTGTACGACCAAAACTCGCAG
TGCCTGAGTCAAAGCGAAGAACTCGCTCTCAAGTTCGAGCGCAACCAACTCCGTCTCTGGAGAAACCTCTACACCTACTACGGCGTCGACTACACGTCCG
CGCAGCAGCCATATCCGAGCGTTCAGACTGTATTCCCGCCTTCCATGGACACGTATCCAGCTTATGCAGGTACTGGCTACAACTACAGTCATGAACGCAG
CGAAAACCGTGAAGACAAGTCGATCAAACTGGGTCTGGGGGACTTCATTTTCTATAGCGTACTGGTTGCTCGTGCGTCGTTGcacggcttcgacgtgttT
GCTGCCTGTTTCCTCAGTATCTTAGTGGtaagtctccactgctgtcGACATTCGTGAGGTCTTTTTAACAATATGTTTATCTGTCAGGGTCTGGGGATAA
CCCTTTACTTGCTCGCACGCTTCGATGCTCTACCGGCGCTCCCGATCTCGTTGTTCCTGGGCATCACCATCTACCTACTCATGGTCACCATGATCTCCCC
GTTATTGGACGAACTTCAGGCCAGCAACGTCTTCGGCATCTAGAACGTAAGTTACATACTCGTGTCTCGGCTGCTTTTCCAGCGGCATGTCAATCGGAAC
AGTCAGTGTTGCACGTCGTTTCTCAGTCGTTTTTTCTCGTCTGCTAAAGATTCTTTTGTAAAGAAGCAACGTGGCAACGTGACCATGGAGTGGCTCTCGT
CAAGAGCCTCTTGAGCATTGGGAACCTTCCGGCGTATCCTGAACGACGCCCGCGCATGGTTTGGAGTTCCACGTTCCTCGTTAGTCATCACGACGTCAGC
TCGCGGGCTTAGGTGGTCGATCAATGGTTGCACAGCAGTATGGGCATGTCTTTGGGCTAAAATTTGACGAGATCTGGCAGAACCCGACGAGgagtacact
gtactgtacagccAGGAAACCTCAGAGCCGTTGAGGGTCAGATATCAAAAACGGGCTGACCGCCAAAATTGCCACCAAAACGATGTCGCTGCATCCCAtt
gcggtgcagcagcaagtggctCAACCAGCgtgtgctacatgtattactgGAAAGGAAGAGCAGGGTCTTCATTGCTTGGTGCTGCCGTCGCGCCGTAGGT
CAGCGCAGCTTCCTTCCATGCACCTGAAGTGTCAACTGCCCCCATAAATCATGATTAGGCACTTTAGCCTAAAGTTTAGACACTGCAATAGACCTCTTGA
AACCGATCACCAAAGATACTTTTTGTTGAACTGGCTatacaacttcaacttgggcCAAAACCGTCATCAGACGAAGGTTGGACTTGGAAGTGTTGTCCAT
TGATTTcgtgcaacttgcaagtgAGAGCGAGTTGCCTTGGTGGGAGTGGCATACTGATTGAAGACGAGCCGGGGTGAAAAGTGTCCCTGGGGCTCGTGCA
GAGAGAAACAGATTATTCGCCGCACGCGACTGCGGCCCGTTACGTCGTCGCAAAGCCCCCCCAAGGCTCATTTGCATCCTCACAAACCAAGCGGAATTTG
TTTTACTTTTCACTTACAAAAAGTGTGATAAAAAAATCTTTAAGTTTCAGTAGTTTCACGAAATCAAAAAAGTCAAGTCAACTACCGTTTGTAGCTTCAT
CCTCAGTTGAGAGAATTTTTCTCACGCCGCAGTAAAAAACAATCGCCAAATAAAATGGCGACGTTTTTATTTATTCTTCCTTTGACGCTTTTTCGGGGCG
GCTTCTGGTTATCCTATTATTTCCTTCCGATCCGGGCGTTACCCTTGCTGGTTCCTAGGTTCAGAgcgtgcaggaagctcaCGCAGGTTTCTCCAGCATT
CAAACACTCGCCGCCCACCCACGGACGAGCTCCGCCCTTCGATCGCAGAGGGGACTCAGTTAAACATGGAGCCGCCGGGTGCAACGGTAGAGTGGGCAAC
CACTACGAAACTTGAGTCGAGACTCGACGAAGCCTCAGCGAGGAAGCATCCAGGCTGCACGTGGCCACCCGAGAAAGCCGCCGGTCATCAACGCTCGCAG
ATGGTGGCAGTGTGGCAGGGCAATGGggtccgccagctccatgAGCCGCATGTCGGTGGAGTCCCCCGGTCCGTCTTGCAGCGGTTGTTAGCGACGCCCT
CCGAAAGTGGCCCGAGCACGCCACTGCATAGCCCCCGCCGTCGGTGCTCCGCCGCGTCGGCTGCTGTGGCGGCCATGGTGCACAGTCCGAGAGCGTTCGC
CAGCAACGACCGCCTTGTGCTTGAAAAGAGAGACCCCACGGCCCAAACGGTGCCTTGTCCGTGCTTTTCGCCCGTGTTCCCGACCCCCGGGTTCGGTAGT
TACGAAAGTAgtagcaactgcagcagtcgGTGCAACAGCCCCGTCCCGACGAGCCCCTTCCCGGATCGCCCCATTCCAtccgacgacgaagaagacgaaa
acgaagacgacgttgtcATGCTGCGCCAACAGGTAGCGCTGCTGATCAAGAGcttggaggacgagaagaaacgGCGCGCGTCTgagcagcagttgatgcA
GACTGTAAGTCGTGATAGTTCACCCGCTTTTGCAACTGTAGATAACTGACCTTTTGTGTCCTGGTAGAAAATCATCGAGCTTCAAGGCTTGATCCGTGGG
AATGAACacgaggacgagatggagTCGTACGGAGACaggaagacgcagcacgGCTTTCCCTCAGCTCGAGAGAACGAACGACTGGAGAACAACCAAGTCA
GACGATGGTCGGCAccactggaggaggacgaaggagTCAAAGCTTCGTCTTGTGGCTGCTCCCGGAAGAAACAGGACTCgaatggagaagcagcggctaA
ACTGCAGCTCACGCGGCTCCGTGCACGGATGCACGCCATTGTCATCGACGCCCAACGCGAAACTCAGTACGTTCATGGCTAGACACATATTGTACGTGGT
AGTTAGTTCCTTACCGGCGTTCGTACCTGCAGATCTCTGCGATCCCAACTGGAAGCGACGAAGCGAAGCCACAACAAACgggagaaggagctgacaCTTG
AGACGACCATTAAAGTCGCAGCAttggagcagaagcacgcCGTGGCCACCACTCGCCTCGCGCAGCAAGCTGCCAGCAGTGATGCACAAGTGGAGACACT
GGAGGCCGAaaagctggagctcctcgcgGTCGTGCAGGCacaacaggagcagctgaagcagctgaaaCTAGCTCTCGGCGGTAAACAGATCGTGGATGCC
TCTCGATGAACGCGAGTCGATAGGTGAAGCCCCCATGGTTGATTTTTCTTATAAGTGGTGAATGTGCAGCCTCCGTATTACTGCGCTGAAGCAGGAAACG
CACAAAGACTGGGGGCCGGGGAGGGGAAATTCTGTATGAGCAGACAACAAAATGACATAATAGAAACAGAGAGGGGAGAAGCATCAGTGCACTGCATGGA
GACGATCGACAGTCTACCTGGggtctgctgctctgctgctctgctgcttcactcTCTCCTGGCAATCCCTAGCAAGCTACACAGCACACACCATAGCTGA
CAGTGGTAAGGATGCCACAAAACTATAGAATAACAATATCAACAGCACAGCCTTGCCACCTGGATGCACGCCCAGAGCCGCTGAAGTGGTGATCGAGGTT
CGTGGTATATTACGAAGTCGCGTTAAACTTCACCcggatctcctcctcgcccaGCAGGCCAGCAGTAATCGAGTTGATGTTTCCCGTGAACACGCGTCGT
TCCCATGTTGTCGTGTCGAAGTACAGGAACTGCGgcgccatggagctgtttgCTAATGAAGGTCCTGTGCTGGAGCCCATGGCGCTACCAATCGAGCCAA
TGCTGCCATTGCCGTTTGCACCGGTGGGCGACCCACTGCTTGACCCCCCTACAGAAGAGTTTCCATTACCAGCCAATagagcagcatcagctggagacgc
acgCTTCAACCAAGTCTTCAATTCCGCGTGATATCTCCACTCGCGGCTGTACAGCTCCTGGGCGGCGTAGGCTTGCAAGACATCCTTGGGCATCGAGTaa
aagatgaagaacagcgTCTCAAGGTGAAATTTGGACAGGTGCGTCGTCTTGAGCACCGGCGGCTGGTTGTAATAGCACATTGGCAACGAGAATTGCGGCT
CTTTTGTCAGCTGCTCCTCGGACCAGGGGGATGCAAACGTTGGGTACAATGGCCTGGACAACACACAGCGTTAACAACGCACAAACATACACACAAAAGC
AAGCCTTAGGAACGTACTCTGTCGAGTTGAGATTTAAACCCAGCGACGTCAGATCGCAGCCCATTGCtaggttcttcttcgagtcaTTGCTTGGCCGGAT
GATGGTGTGCAGCATTCCCAGAAGTCCGTACTGATTGCTTGGATCCAGCTCCCCGTTGCTATTTTCCTCCTTCGTagcctgctcttcctgccgAGGCGCC
CGGAAATGATCGAATGCCTCAGTGCCTAGATTTACGCTGCCACCAGATATTGCCTGCACAGCGCTGCCAGCTCGGCTCCCTATAGAAGTGCCGcccttct
gctgctccaacCGTGAGGACACCATCCCGTCCGCTGCAGACGAAGTGAAGCTCGAGTGTCTCTTGAGCTCCGTAGGTGGTCGCAGAGGGCTTTTCTCGCT
GGGAGCAGGTCCGAACGTTGACAGAGCAGGAAAATCCTCCTTCTGGATGACGAACTCGGACGGCTGCGCGCGCATACGATCCGCTGCAGTGCCTTCAAAG
CTTGCGTCCAGTGACAGTGAGCCCATCCTGCCCAGCAAAGCGCACTTGTTAACTTTATCCAGCAACAAAAACGGCGTAAAGAAGCCTACCTAGACCCAAG
AGCAGGGAACTCTGACATGTCCGGCGCCTTGTTCTCTGTCGGCAATTGGAAATTCCGTCCTACTCAATAAATAACAGCAAAAACATGAGTTATCACGGTA
GACCGCCGGAATTTAATCCGTTTTCTTCTCGTTAACGCACCGGAATTGATGCGGTGCAACTCATGAGTGGGTGGAAGTGCCCCTGCTCCCATTTGCATGC
GTCCAACTCCAGATCCGCCTAAAAACTGCAGTAAAATGTTAACAAAACAGCTAAAAACAGCCAAA