Description :
From Genome Similarity Track
Location :
contig_64:99847- 101721
Transcript NameFunction/comments
g11544.t1hypothetical protein

Sequence
1874 bases(100 bases per row)
TGCTACCCAGCTTCCTACTCAAGGTGAATTCGTGCCGCGGCACGAACCACTTTATCATCTTGGTGTTCTGCGTCGTGGCTTCGAGTCTCGTATTCATCTT
GGATGCCGAAGTGACGGTGTTGTCTGGTGTCTTCGCGCTCGCGTTCCTCTGCGTGCTGCTGTCGTTCACGATTGCTTGTCTGCTACTGAAGATCGGCCGT
GAAGAAATCCCGCGCAAAAGAACAACGTCGTGGTTCAACACTTGCTTCTGCCTGGGTATGATCACGTTGGGAATTCTTGCGAATGCGTTCTCCGATATCA
AGGCGCTGTCGTATTTCTTCATCTACTTCGCCGTCTTCTTCCTGGTCGTGTTCCTGATGCTGACCCGCGTGAGTCTGCTCAAGGGATTACTCTACATTTC
GCGCAAGCTGTTGCTGCACTTCCGAGGTCACAGTGAGTCAGTATCCATGCAGCAGCTCTCGGTTCAGGGCCAGGCTTTTGTCGGCAGTGTGAAGATTGCC
AAGACGATCGAGACGATCAAGAACACGCCTGTGGTCTTCTTCTGCAAGGTGGCCAACTTGCCCAAGATCAACGAGGCGGTGCGGTACGTGATGCAGAACG
AGCACACGTACTGCCTGCGACTCGTTCACGTGTGCGAGCCGAAGGCGCCTGTGCCGCGTGAGTTTGAGCACGTGGTGAACTTGTTTGACCACATTTACCC
GTCGATCAAGATCGATTTCATCGCCGTGACGGGAGCGTTTGACCCGGCGATGGTGCAGTGGCTGTCGAAATCGATGGCTGTTCCTACGAACATGATGTTC
ATGCGTCAACCCGCTAACGAGAACATCCACCGCGTGTCGGCGCTTGGCGTGCGTGTCATTACGGATTAGACGTTCACGAGTCTACTTCGGCTAGCGAGTG
GACTTGCTAAGTTAAAGAGAGAGCTCGAGTTTGCTGTTTCGTGTCAAGGATGATCGCACCGCTTTCCGGTATCCGGATACTGTACCTACATGTTCACGTA
CATGTACACGGATGGTTTGGAAATTGACTTTCGGTTCGCAGTGGTAGACTGCCGCAATGATTGCCAGTTTGCGACAGGTACTGGTACAAAAGCTCACGTG
TGATAGGCAGGCACTCTGCAATCATGGGATGTGACTCCGATTAGCATGTCCGACTGCCAGTCGGCGACTGGGGAGTTGGTCATTGTCCATTTCTCCAGTT
CAGACTGAGAGCGCAGTCGCCGCCGCGTCACTCTGCAGCGGCATGTCGTCGCCTCTTTTCATCTTGGCAGTGTTCCTCGCAATAACTGCAGCAGCTGAGC
ACCGCAACACGCTGCACAACTTGCAGAATGAGACGATGACAGAATGGCCATCATTGCGCTTCCATTTCACCATCAAGCGCGACGCCATGCAAGTTCACGG
CCACTCCGAGTTCTCTGTGCTGGCTAACCCTGTTGTGTCCACCAATGGCGATAACAGTGACAGCGTGCTGTACGACACCTTTGCTACGTTCGAGGAGGAC
TCGATGATGCACACCTACACACTCGTAGACGGTATCGCGTACGTCTCCGAGAGCTCTGTGGACGATATCAGCGTTGACCCTTTGGTGAAATGCGTGGAGT
CAGGAGTTCTGATTCCAATCAACTCGATCGTGTTGGCACTCAACGAGGCTGTTCCTGTCTCGAGTATCTCATCGAAAAGTAGCGGAACCATCGAGTGTTC
CAGTGGGAACACGTTCAAAGCCACAGTAAACGGTTTTGATCTCGGATTGTGTTTCTCGGATTCTTCCGGATTCACGATGTATGGCAACGATATGAATATC
GCCGTGGAGTATTTGGAGAGTCGTGAAGACATTGCCGCGCCAACGATCAAGAGTGACGTGAAGAATGAGTGCGA