Description :
From Genome Similarity Track
Location :
scaffold_29:99842- 101151
Sequence
1309 bases(100 bases per row)
TCGCTAAGATGTCGGGCTTGTACAACAAGTAATATGCGCGTCACTGTCGCGCCAAAACAAAATAGCAGTGCATCTTACTTTTGGTGAACACCACAGGCAA
GGCTCTCCGCATAACAATCTTACACAGTAATGCTCATCAACAAAAACGAGGAACCTACGCGAAAAGCGTACATATCGGCCATCCTCTGCACGAACTCGGC
AAGCGAGAAAAGTTTGACACGAGTGGGATTCGAACCCACGCCCGAAGACTGGTGCCTAAAACCAGCGCCTTAGACCGCTCGGCCATCGTGTCTTACGAAA
TATAATATATCTTTGAGTATACAAGTAGTACCAATTGTTCAACATTAAAACAATTCCACCCTCCAGAAAGCCTTTTACACTGTGCCTTACCAATACCTAA
AGGCTAAAGCAGTATTTATATTTACTTATAAGTACTACTTGAATCATCCTTTCGTGTTGCCACGCTGCTAGTGTTGGAGTGTACGAAGTACTTGTGTGTT
TTGTTTCATTTCTGTAAAACATTACTAGTACATTACAAAATTCACTAAGTACGTTTTGATCGCAGCGGTCGCAAAGCACTCACTCTCGTCCAGTCTTCCA
GCAGCCATGGCATTCATCACAACAGCTCGTCTTGCTGCCCGCGCCGTCGCCCGCTCACACGTGTCCAGTACTCTGCGTGCTTCTCCACTGCTGGCCAATG
CATTGTCTTCGCAGGAACAGCGCTCGTTCTGCGTCGTGGAGCCTCCGTTCCTGTCGACCAGTGGCAGTCTCGGCGCCGTCCGCACCAAAGTGAGCGAACG
CGCGCTGCGTCGCAAGAACCTGCGCAAGATGAAGAGCCAGAAGGGAGGCAAGGTGCCGATGCTCAAGGACACACTGCGTAAGCTGTATCTGCGCACGCAC
CCAGACCTGTTTGGACGGTACCCGGAGCAACAACGTGCGAACGAGGAGTCGTACAAGGAATTGCTGGGCATCTTGGACGCGATCGAGAAGCACAACGAGT
TCCCTCCAGCCAAGACGTTGGTACTTCCATTCTTCCTGAAGACACCGGTGGAGGGTGAGTTCAAGGAGGTGGATCTACAGCTACGCACGACGGGAGGCGC
GTGCAACACGTTGGTGGAGGAGGCTCTGGGTCGCTTCTTCGGTGAATGCGGTCTCCCACAGGCGTTTCAATGGGGTGAGGGTAGCTGGGGTAAAGCTGTG
GGTAAGGACGCGGTGGAGAACTCGAACTTGGGTTTTGATAAGGAAGAGGAGGCTCGTGAGAAGGCTCGCAAGGAGGCGGAGGCGGCAGCGAAGCGCGAGG
AACAGATTA