Description :
From Genome Similarity Track
Location :
Scaffold_126:9984- 12698
Sequence
2714 bases(100 bases per row)
TTGCGTTCAGCTGGTTGCAGCTGGTGAGTCTGGTAACAGACGACACGCGCCACATTATCTGCATCGTATTGCATTAATGCACAGCCGATTGCGAAGTCAT
TGGTGTCACCGACTTGTGGAATGATATGTCTTGATCTGCAATCGACAAAACTGGCGATCAAGCTCTGCTTGATACCTTCGAAGGAGCGCTGAAAATCATC
ACTCCATACCCACTTCTTGTTCGTTATCAATAGACGAGAGAGATATATGAACAGTCATCTCGGCGTAATTGCGTGAATATTTATGCAAATACGCCGCTAG
GCCAAAGAGCTTTCGAAGTCCCTTGACTTCTGTAGGCACCGGCCAGTCGGTGATCGCCTTGATCTTTTCTGTATCGGGCCGGACGCCATGCTTGCCCACG
ATGCACGACCCAAGAAGTGGTATTTCGCTAGCACCAAATATACACTTCTTGAGGTTGGCTGGCGTACAACTTATGCTCGCGCATTAGTGTAAGAACATTC
CGGACGTGGAGTCGGTGGACTTCCAAATTCGTCAGTCCATCCATAGCCGGGCTATGGACGAACACATCATCGAAGTAACTGGGTGCAAAGTCTCTTACTG
GTCTCAACAGATTTGAAACACATCTGTTGAATAGGGCAGGGGCATTACTTATCCCTTGTGGCATCACCAGCCACTCCCAGAGCATATCGCTTGTGGTGCT
CACTGCAGTATAGGGAATGTCCCTTTCGCGAAAAGGATCTAATAGAACCCATCCATCAGATCCATGGATGAAAAGATGGTACTCTTAGCTATACCATCTA
TGATGACATCTTTCCTTGGTATTGCTGTTTGAGCCGGTACCGTTGCAGCATTCAACTTGCTTAATGAATGGCCTTGCGCACACAAAAGTTCGGAGAGCTA
TGTGGGGAGGTTGACTCCCTCACATGAACCGCTGCAGAACGATCGGCAAAGAATTTGTCGACCGCTAGTACTTATTCACGGGGCATTCCTTCATGACACA
GTACTTCACACCCGGTTTCAGGTCAACTTCGTGACGAGTACCTTTGTCCTTAGGTAGCTCGCACGGCACTGCTTCTGGGAAAAACATCCCTGAACTCAAT
ATAATCATCGGAGAGAGAATTTGTTTGGAGCGATTCCCACGACTGAGATGTATATCGCTCAATTGGTGTCTTCTCATCAAGGACACTCTCGACCATTCAT
GAGCTGCTGAGAAGCCTTCATTCTCGGCAAAGACCATTGCCGATCGGATATCGGTGACATACTCGTCCTCTGGGACGAGTACGCAGATCTGCTTGGATTT
GCCACTACGAAGATCACGTGAGAACCTCTTCTGTCCTAGGGTGGGCAATTGAGTGATCTCCGAAGTTGACTTTGGAGGCGCGATCAGATCAAGTTTTTAG
GTATCTATACTTGATCCGTCATTGACCAGGACATTTAATGTCGCCAGCTGAATTGTGGCTCGTACCTTCTGAGCCACGGTAAACCAAGGATGACATCAAA
CTTGTATCCAAGTCCAATACGATGAAGTCATCACCGTATTGAACTTCTTTCAGTGTATAGGTAACTTTCACTACACGCTCTATCACTGTTACGAATGCGC
CTGTAGCGAGGCGTACCGTTATCCTCGTTGGAGGGATCTCTCGCTCGATGTATTTGAGCTTGCTGTTGTCTAGCGATTGGCGTCGTACAAAGTTGTTTGA
CACCCCACAATCGACCAGGGCTCATAGTGACATGTCATTTGTCATTTCGACTCGTGGTAATGAGGGGAACCTAATTACCAGATGCAGTAGCACACAATGA
TTGGGTGTCGGGAGCAATTCTCGTCAAAAGGCCTGCAAATTCAGTTGACGTTGCTGGATCAGCAGATGATTTGCACCTACTGACCCCGACCGTATTCGGT
CGTCCGTCACGATATAGCGTCTGCGCACCAACGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN