Description :
From Genome Similarity Track
Location :
Scaffold_254:9983- 12303
Transcript NameFunction/comments
g15395.t1hypothetical protein

Sequence
2320 bases(100 bases per row)
CTCTCTAGAAACTTGGGAGGAGAGGTATTTCCGAACCCCTCTTCCTCTTACGATCGATCCCCCTCCGGGGTGACCGAGTCGACCGCGGCTGGAATTCATC
CATCCCGGGAACAGTTTAAGTCTGTGCGACTTGACGTGGGAACGATGTTACCCACGTCGGGTGAAGCCACCATGGGCTCACCTCTTCCGTGAATGGTGTG
TGGAACTATGTTACCCACACAGGAAGCGCAACCCGCGTCTTCCTCTTCAGTTAAGGTCTGGGCGACCGGGCGCGATATACATTGCGCCAGGCACGACGTC
AACCATGTGACTCGTGCCGTGAATTGAAACACTGGGTTCTTCGGAACCCAAGCGCAGCTTGCGCTTCGGCATACAAGGGTCAGTAATGCTGACACCTCGG
CCTGTGGTAGCAGCTGATAACCGGCTGCACCATCGAGCCGACCGTGTCTGAGGAGCATAGCTCCGAGTCGTTCATTGCGACTCCGGTCTGGTACGTGCCT
AGACCCGACTTTCGGCGGCGACGGTGTCGTCGGCGGTCATCAGGACGTGGAACTAAGTTACCCACGTCTTGGTGGCGGTGCCAGGAGTCTTATCGACTCC
GTGTGGAACTTGGTTACCCACACAGGAGGTGCTTATAGCAACCTCCAGCTGGCCACGATCTCGGCCGTGGACTTAAACCACCGGTCCGGTAGTGCCACAC
GGCACTACTGAAGTCGAAGGCCGTACGGCGCGACGACTTCTCGGCGATGACCGCTGTGGTATAGCGCAGCCACACATGCCGGGCAAGACGCCCTGTCCAT
CGGCTAAGCCTTTGACGGTCCGCGAGGGTTACCCGCGATGGACATGGTCTTGCGACCTGTTGACGTAGTTATGCGTAACTACGTCAACGGAATTCTTCCA
GGACGTTCCTGTCCATAACAGAAAAAGAGTTCAACTCTTCAGGAGAGGTCTCCGGTTACAGGAGTACCATCTCCTCAGCCTTCAGGCTGACCAGGAAGTC
GTGCAGTGACATTCCCTAAAGGGAAACTGTGACGAAGTCGATGAAACTTTCTCGCCCAAGTGTATAGCGGTAGCCTAGACTTAGTCCTGAAACTTAAACC
TGGGGGGTGTAAACCCTGAACGCGGTTCCTTGAAACCGTGATTGAGAGTGGCGTGGCACCTTGTGTAATCCCTATCGGCGTCGATTGCTTCGGAGGAAGC
CCGGATATATCACCACAGTGAGTTGTCAAATACAAATAGGCCTTGGAAATGCTAAGCGTAACGTCCACTTCCTGAACGCACTTCTCCAATGTCTGGAACC
GGTATCGAGAACTCGGAACAAACACCGCTTTCAGATACCCAATACAAATACAGAGTTATATACAACACGCAGCCGTTACTTATTCTTATAGACCCTTGAA
CGGTGGGTCTGAACACCAGTCAACTAAGGCTGATTCCAGGATACTGGTCAATCCTGAAGCCTTTTCTTCACACGCGCACCACCCTCAGATGAGGGAAATA
ATACACACCAATACAATCCTATCTCAAACGCAGTCTATCAAATATTCCTGGGGATGACTGCTACTATCACCCAAGAAGGCCTTGTTAATATGAAATGAAA
ACCCCGCCCTTACCATACGCGCAGCGGGTCCAACTAATATAGGGAATGCAAGGATCACGTCAAATACTTACGTGAATGATCCCCTCGCAACTGGGCTTGA
ATCTTGTAGAGAGCCCCGCACCGAACTGCCCTTAACTGAACGGCGGACCCGTGTCCTGCTTGTCAGAAGCTCACTTATTTGAGCGACTTGCGTAGTAGGG
GGTTAAACGAACTCTGATTGTTATCTTTGCTAGCCGATCGCTAGCTTCTTCGTAAAGGGTATCTGTCTGTCTTCGTTCTTCTGTGTTCTTCTGTGTTCTT
CTGTGTTCTTCCTGGCGACCTTCTGACTTTGACTTGACTTGAGTATACTGGCTGTCACTTCGTGGGTTCACTTTCCATCTTCAAGGAGTCAAATCCTCGC
ATTGGGTTCTGGGTTGTCTGAACGTGGGTTCTTCAAACCTACTTTCAAGTTACTTGACCTTGAACATCATTTTCAGGTTCCAATTTCTTGAACGTAGATA
CTTCGAACTCACGCTCAGGGTTCTTCAACTTGGACATTTAGCTGAAACCAGTGTGTACGACCTCACAGTACAGGGTAGTCTTGAGCACGTATAATACATG
CGTTCAGACATCCGCGTTCAGACATGTGATCAAGGTCTCATGACCAAAATCATACTTCATTGTGAGTGTCCAGACGGCATTTCTTCAACGGGCTTTTTGT
TTGTCTGGCGTCTGGTGACT