Description :
From Genome Similarity Track
Location :
Scaffold_398:9978- 11181
Transcript NameFunction/comments
Hyaar_Emoy2814016DEAD/DEAH box RNA helicase putative

Sequence
1203 bases(100 bases per row)
CTTTGGTTTTGCGCGGCCCACGAACGTGCAGGTCCAAACGATTCCGTCCGTTTTGAAAGGGAATGATATTCTGATCAAGAGCGAAACGGGGTCGGGTAAA
ACGCTGTCGTACTTGCTGCCTATTGTTCAGAAATTGCAGAATGTGACACCGCGCGTTCAGCGTCAGGACGGTTGCCTGGCGCTAGTGCTAGCGCCGACCC
GCGAGTTGTGTACACAAATACTGGAGACTACCATTAAACTGATCCAGCCGTTTGTATATATTGTACCGGGTGCTATTATCGGTGGTGAGAAGAAGAAGGC
TGAGAAGGCACGACTGCGTAAGGGAATCACTATCTTGGTTGCCACTCCTGGCCGGTTGGCCGATCATTTGGTAAACACCCAGTCATTCAACTACACAGGC
CTGCAGTTCTTAGTACTGGATGAGGCAGATCGCTTGCTGGATATGGGTTTTGAGAAGCAAATTACGCAGATCTTGGCCATTCTAGATGGCAAGAAGACAG
CTCGGAAGAGACAGAACATTCTGGTATCCGCCACCATCAACAGCGGGGTGCAGCAGCTTGCCATGTTGAGTCTGTCGAGCCCTGTGCTGATCGATGTCGA
TGCAACTAACAGCGATGAAGACGCACTATCAGAGACCAAAGGGTCTGGTCAGGAGAAGTTTTCGACTCCACATCAACTCATGCAGCACTTCATGCTCGTT
CCAGCAAAGGCGCGCTTGTGTGCACTGACGTGCTTCTTACGTGAGGAGTTGCGAAACGCTCCTCGCGATGACAAGAATGGTAGGCCTAGCAAGTGTAAAG
TCGTAGTATTCTTGTCCACGTGTGATGCTGTGGACTTTCACTACACGCTGTTCCGCAAGTGCGCGTGGCCGTCAGGAAAGGGGTCACCTGGAAACGACGA
CACAGCAGGCGAACAGAATGGTGTGGCCTCCCTGTTTGGTAATCAAGGACCCGTGTTCCGCCTGCATGGTAACATCCCGCAGCAAGAGCGCGTCACCACG
TTCAAGAGTTTCTGCTCTTCAAGTTCCGGCGTGCTTCTCTGTACCGATGTGGCTGCCCGTGGTCTGAACTTGCCTACGGTGAAGTGGATCGTTCAATACG
ATCCGCCCACTGAGACCCGTGACTACGTCCATCGTGTTGGTCGAACTGCCCGAAGTGGCAACCAAGGCAGCAGCCTGTTGTTCTTGATGCCTTCTGAATC
GGA