Description :
From Genome Similarity Track
Location :
Scaffold_13:99744- 101137
Transcript NameFunction/comments
Aphas_H257_05676Hypothetical protein

Sequence
1393 bases(100 bases per row)
TTTGAGTGCTTTCCCACCAATTTGTCACTTTCGCGCGAAATGAAGGCGTCCAAACCATCGACCAAACTCGCCGCGGCTGATGTGCCGCTCTTCGCCGTGA
ATGATATCATCCTAGTGAAGCACGGCATTGAGATCTTCGATGCCAAGATCCTGCGCTTGGACGAGAACAGTATGGGTCCATGCAACTTCTCCACGTCTGT
GCCACGACGGACCTTGCCGTGACCGTTGTCTGTGCATAGGCGACGTGCCACACTACTTTGTCCATTACAACGGCTGGCACAAGAAGTGGGACGAATGGGT
CTCTTCGGATCGTGTGCTGGACACGAGTCCTGAATCACGCGAACTCCAGAAGCAAGCTAGCTTGAATGCCAAGGAGCAGGTACCCCGTCCAACCACACGA
CTTGTGTCTTCTCCAATGATGATGTGCGCAGGTGAAACGAAAGGCGACGACGGCTACCATTACGTCGTCGGGTACGGCCCACGCAACTCTGGAACGAACC
CATACTCATGCATGTCGTCATGTGTTGTAGGCGTGATGAAGAAGAAGTCCAAGGTGGTCGACCCGTTTGACGACTCGGTGGTGATCAAGGACCATGCGCG
GGATCTCGAAGAGGTACTTCCATGCATTCATGGACATGCTATGCTTACACAAGCGGCAGGTCGTGCAGGAAGTCCAAGTGTCGATTCCCATCCCCATGAC
ACTCAAGAAGGTCCTCATCGACGACTGGAAGAAGATCACCCAAGAACAGCAGTGGATCGATATGCCCCGCGTACCCAGCGTCCGCTCGGTACGTCCACCC
GCCCGCGCTCTTTCTACCTCCTTCCTCATCCTCCACACATACGAAGGTCATTGCCGACTATCTCGACCACGAAGCCACCAAAGAGCACGACCTTGAGGTG
CGTAGCCAGCGTCAGCTGCGATTGAAACGCTGCTACTAGATCACCCGCCCCATGCTGGAAGGCCTCGAAGCGTACTTTAATCGAGCACTGCCGCTCATCC
TCCTCTACCGGCACGAGCGCGCCCAGTACGACCAGATCGCCGACTCTTCCACCGTGACCGACGACAGCTCGGCCGCCGATCGCGCCGCCGCCGCCCCCGC
CGCGATCTACGGCGCCGAGCACCTTCTCCGACTCTTTGGTACTGCTATTGATGGTCTTGTATGGTAGAAAACCTCGTACTGTACGTAGTGCGGCTGCCAC
TGCTCATGAGTCAAATGGGACTGGATCTGCCGCAGTCGGACCAGCTGCGCATCCAGGGCACGCTGACGGCGTTCCTAAAGTATATGCAAAAGAACCGCCA
AACGTACTTGGCTCCCCAATACATTGGTAAGCCGAAATCTATGTCAATATACTAAGTCATTCGGTAGCATCGAGCGCGTTTGTGTGGCGTCCA