Description :
From Genome Similarity Track
Location :
Scaffold_32:99705- 103780
Transcript NameFunction/comments
Physo_134460reverse transcriptase
Physo_134461hypothetical protein
Physo_134462hypothetical protein

Sequence
4075 bases(100 bases per row)
ACAGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACG
ATCACGAGGGTCGTGATCGTGTCGTCTAGTACCAATCGCGTCAGCTGAAGCCAGCTGAGCCCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAA
GTACGCACTCGCGAAGTTCCGAGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACAT
CTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCG
CGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCG
CGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGTTGCCGAAGCATCTTCGTGCTCGTGC
ACACCGTTATCGGGTGCACGACGGGTTATTTCTCTATAGTGCCGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGG
ATCCTGTACGAGTATCACGATGCACCGACTGCGGGACATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATA
AATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACATGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGGGA
GTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAACCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACAGCTTCAGCAAGATG
GTACATCTTGCTGCAGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTG
TGTCGGATCGGGACCCGCGCTTCACTGCACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGG
ACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTACCGATGGCGGAGTT
CGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACCCCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCT
CCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACACAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAACAAGAAGA
AGAAGCACGCGTCTGTGCAGGGCACAGACGCCGACAAGAGCAAGAAGAAGAAGAACGGGCCTGTGTAGGGCACAGACACCGCGAAGACGAACGCAGAGGC
CGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATC
GCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAGCTCAAA
ACCTGCCTAAATATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACAC
ACTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAG
CGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGTGCGACGCGACCTCCCACGTCGGCAGAGATGTCCGATGCGGT
CTGCGAGTCCTGAGCGACTTGAGCCCTCAGAATCGCCACCTCCTGCTTCAGAGCGGCGAACTCCCGGCTCTGATGCTGTTCCATAGCAGCGACCCGCTCC
TCGAGCGTCGGACCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCACCGCCTCCGATCCGCGATGCCCGCGGCTCAACACGCTGG
ATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACAT
GGGAGCCGCGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCACCACGCACTGCCGGCGCGAAGGTAGTGCGAGCGCTGTAG
TCACCCGCAGCGCCCGAAGTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGAATCGTCGTGT
ACCCGTTTAGGTCGCGGTCGCTCAAGCGTGCCGCACCCGGAAGACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGA
GCTGCTCCAGCCGCCCGCGCGTCGAGAATGTCTCGAAGCGCTCACGGGCATGCTTAACCCGCTCGCGGTAAGCTGCTGGTTTCTTGTTGAAGTTCTCAAC
AAAAGCATTCCAACTCTGACAAAGTGCCTGCCACTCAGGCACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTACCGGAGCTCGTGGAAGAGCCCC
ATGTAATAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCAACAGCATCGTCGTGGATAGCGCTGCATACGTACAGCGGGATTTCAT
TCGGTGGCACCGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCTCAGGCAGCGCGCGGAGAGCTTGAAGGCGC
CACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCAGAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCA
CGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCGCTTGCTAGAAGAAGCATCGCCCTCTTCCATCTCCACGTCGT
CGTCCTCGAAGTCAACGGCGTCGTTGACTACAGAAGAACCTTCAAGGACAATCTCTGGTTGAGTTGTCCCCGCCGCAGCCTTGGTAGCAAGAGCGTCACG
CTTTGCTTTGAGACGCTCGCGGTACTCGGGGATAGAGAGAGTATCTATCCCGGCGGAGGACTTCCCCTCTGCTGCAGCGTCGGTCTTTTTCTGAGGCGAG
CTCATTGCGAAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCCTGATTGACGTGCCGTGACTCGGCGCGTCTAACCT
TGAGGGGGGGATGGTGTAACAGGGTTACACACACAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAATACTTTCTC
GACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGGCGGGTGGTCCATAGAGACTTATGATTCTTATTGGCTGAGAGCAGCATCTC
TTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCATTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAA
AACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTT
AAACTTAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTATA