Description :
From Genome Similarity Track
Location :
Scaffold_835:9968- 11035
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_835-snap-gene-0.6Glutathione S-transferase

Sequence
1067 bases(100 bases per row)
CACCATGTCATCCTTCCCATCACTACGCCTCACTTACTTCGAAGCCAAGGGCCGCGCTGAAGCCACACGCGTCGTGCTCTTCATGGCCAACATCCCGTTT
GTCGACGAACGTCTGAGTCCTCAAGACTTTGCTACTCGTCGCGACTCACTGCCATACCACAAACTGCCGGTTCTCCGCGTCAACGGCGAAATCGTCGCCG
AATCTCGTGGCATCCTGCGTTACGCAGCCCGCCTTGCCAACATGTACCCGACGAACGATCCGGTCGCGGCGCTGCTCGTGGATGAGATCCTAGTGGCGTT
TGACGAGGCGTTTGTGCGGGTTATCATGCCAGCATTCCAAGAGAGCGACGCTGAGGTGCGGAAGAAGATGGGGGAACAAATTGCCACAGGAGCTCTGCCA
GCTGCATTTGAAAAaCTCGACGTGCGCGTGAAGGCCATCTCGCAGTATCcGCTCTTCGTTTCGGACCCTGATCGCTTGTTCGTGCACCACGTGCTCATCT
GGGACTTCGTCAACATGTTTAAACTTGGGTTCCTGGACTTCCTCCCTCCGACGGTCGCCGATGCGTTCCCTAACATTATGGCAGTGTTCTACAAGGTTGC
AGCCAACCCACGTGTACAGCTTTGGAGTCGCGGAGTCAATCACGCGCCACCCACAAAGCTCAAGCTCACGTACTTTGATTTCTCTGGTCgAGCAGAGTAC
ATCCGCCTCGCATTCCACATCGGTGGTGTCGACTTCGAGGATGAACGTATCGCATTCGATGACTTTGCCAAGATCAAGTCGACAGTGCCGTACGAGCAGC
TTCCTGTTCTTCATATTGGCGAAGACCTCGTGGTCGCTCAGTCGTTCCCGATCCTTCGCTACGCCGGCACTTTGAGTGGTCTGTACCCCGTTACGGATGC
GTTTCTTGCTGCCAAGATTGACGAGGTGATCGGCCACGTTGAAGAGCAGTTGAATGCAATGAGTgCGGCAGTGCGTGAGCAGGACGAAGGAAAAAaGAag
CGGATGTTTGCAACATTGGTCGAAGATACGATCCCAACGGCACTCGAGACACTGGACAGACGCATTG