Description :
From Genome Similarity Track
Location :
contig_26:99668- 106397
Transcript NameFunction/comments
g6417.t1hypothetical protein
g6418.t1XP_008899287.1 hypothetical protein PPTG_06982 [Phytophthora parasitica INRA-310
g6419.t1hypothetical protein

Sequence
6729 bases(100 bases per row)
TTGCTTCTAGTGAGCGCACAGCCGTTTGCTTCTGGACACCAGCAGCTCGCTTTGATATATCTTGTGTAGTCGTGTCCGTAGATAGTGACACCATGCTATC
GTTGTCATCACCATGGGCAGCCACGTGCTTTTTACGGGCTCGCAGGTAGTGTCAACCTCTTCGGTCGACTATGAAGTTCTCTCCATCCTTCTAGGTGTTT
GAATGGGGTATCCTGTTTGCTCTCGTACATGGTTACCGCGTCTTGGACACGACCCTCATCGGTTTTACCACTTTCGTTGAGCTGTTTGATGGCTACAACA
TACCCACAGAACTTACCCACTGGTGTGAGTCCTACGACGAAAATTGAGAACTGATTGAAGAAAGATTATCCTGGCTTCTTGCTAACTACCGATGCAGTGT
CCTTGACGCTAGAGAGGGGCACACCCAGTGTAGAGTTTCAATTGAACCCATCGACGAAGGGTTTTTACGCTGACCCCAAATGGCGATTTACTGCCAGGAA
GAGTCTTAATTTACGTCTGTCCTAGTTTGGTTCCTGCGGTGGAGAGAGGTGACCGTAATTCATCGAATAATTTGCTGCTGAAACCTCAATTTTCTACCGA
GGTGGAGACACCCTCATATTTCGGGCTAGGACAAACGCAATCTAGCGTTTTCTCGATGGATCTAACAGATCGATCGATCTACCTCAAATCGATCCCTTTT
GCATTTTTGAAAACGCAAATCGATCTATTTAATTCCAAATAAAATACTGGTTTAAACATGTATCACATAACTTTAGACCACCGGAATTCCGTCTAAGTAC
GATCCATTGTCACCCGCTCATTTAACAATTGCGACCACCACGACTGCATCAATCAATGGGAGCCGCCGCCAGCAAGACTTCTTCGTCCGCCGTGGCGCGC
ACCCGTGTGATCCGCACCAACGTGTCTCTGGAGCAGTTGGTGGCGCTGTCCCGCGGCGGCGCAGCGTCGGACCTGCCGTCGCAGCCCTCGGGCCTTGCCG
TGGAGACTTCTTCGACAACCGTGGACGCGCACGGCTCTGAGGTGGAGCTGCTGGAGATGCAGCAGCAGTTGCTGCAGGACGTGCAGAAGATAGAGGATTT
CGATCGCGTCAAGTTTCTGGAGGAGAGCACGCGCGCCTTCGAGGCCACCGCCAGCAGCCACCGCCCCAGGTCCTCGCAGCCCGTGCGGCTGCCCACCGAC
AAGACGAGTGCCGCGTCCTCCACGGGCGTGGGAGGCGCCGACGAGCAGCAAGTGCGCGGCCGCCTCACGACGAGGGACCTGCGTACGCTGCTGCGGCTCC
ACTACGAGCAGCCCCAGAGCTGGACGCACGAGGTGCTGGCCGACAAGTTCGGGCTAGACGCCGACACCATGCGCTGCATCCTCAGCAGCGTGGGCCCGCC
CAATGTGCTGCCGCCCAGAGGCACCTCCGAACACCCAATGGGCGTGTGGTTTGACGCCCCGGGCTTGCTGCCAGTGAAATCCGAGCTGCAGTAGAGTCGC
TCATCCTAAACGTAAATCATAATATGCTAGACAAATGCCAACGTAGTGCTGTCATCTTCAATATGTCGGGAACTTTGCTAGTCAACATGGCACCCAAGCC
TTCCTGCTCGCTCATACTCATAGGTCGGCGGCACCTAGTTTGTGAAGTTGCCTTGCCTTTTGTACTATCGAAGCGTTTCTGTCCGGGCCAGTCGTTTCTC
GACCCACAACGGAAAAACTTAGAAATGGCTGGAAGCACAGCGTCGCTGCCCTCGGCGCTGCCCGTGGCGGCTTCTCCATCGGAGCAGGAGGTGGCCAGCA
TGCAGCACTTCATCGAGAACGCGCTGGACCTGCTCGTCAAGGTAAAATCTCCTCTCCACAATAAAAAGACCCTTAAAAGACTCACCCATTTCCATCTACT
TCCAGGGCAACGCCAAGAGCTACGACTACCTCCTGCAGCAGCTCACGCTCGTGCCCGCGCCCGTGGCCACCAGACGAAAAATCTTCCGCGCGTTGCCACG
CTGCATCTCCGCCATGGCGCGCGAGCCCAGAGCCTACCGCGCGCTGCTGGACGTGCTTTTCAAGTTCGACATGTTGGCTAGTGGAGACCCACTCGAGGTG
GACGACTACACGAGCTTCGTGGTGCACCTCGTGTCGTCCAACACGGTCTACGTGGTGCCCACGCTGCACATGCTGGTGCGCAATCTGCGCCGCCCGCAGA
CGAAGGAGCTGCCGCCGGATCTCAAGGCCCAAATACAGGAGCAGGAGACCCTGAAACCCGTTAAAACGGGTGCAATTGCCATCGGAGGCTCTTTTGGAGC
TGACGTCGCTGCAGTGCCAACGCCCCTGGTGGAACCCAAGGCACCGAGTCTGGACGAACGCATCCAGGCGCGCTTCGAAGCGGCGCACGCCACGCTGGAG
CGCGTGTTGGCACTCGTGCCGACTGCTACGAACGTCCTGTTCCCGATCTTGTGCGAGCACTTCCCGCACAAGCGGATGGATGCACCCACCCAGGTGGCGT
ACCTGCGCAATGTGCTGCGCGTGACAGGATACGTGAGCGGATTGCGTGAGCGCGTGTTGGGGCTTGTGATCGACCAGCTAGTGGCTATCGACGTGGAGAT
CAAGCTGGACGAGAGCGAAGAGGACGTTTTCACCATGGATGATTTCCTAGACGATGATATGCTACCGCCCGATGATGCATCGCGTCAAGTGGACGAGATG
GCTGACAAGCTGGACCAGATGATGCTCGTCATGTTCGAGCACATTGAGCACTCAGCTGCATCTTCGTCACCCGCATCAGTTGAGACGGTGGCTCCCACTG
AGACTAGCAGCAACGAAAAGGATGTGAATGTGCGTCAGGCGGCATTGATCTTCAAGCACCTGCTGAAGGTTTTCGAGCACTCCATCTTGAACACACATCG
CTCCAAGTACCCGCAGTTCTTGCTGTTCTACGTGTGCCGAATGGACCCACAGTTCCAGGACGTGTTCATCTCGCAGTTGCTGGCCACATCGCTAGACCCC
CACACGCCGCCTACTACGCGACAAAGCTGCGGCGCCTACCTGGCCAGCTTCCTCGCTCGAGCCAAGTACATTTCCGTGGCTTATCTTCAGAAGGCTCTAT
ATCACTTGTTGAAGTGGCTGCATGATCAGATGGATGTCTACGACGCGGTACACCAGGAACAAATGGACCAAGACGAAGTTAGGAATGGCGAAAGTGCTGC
TGAAAGAGAAGAGCGCCTGCTGGAAGAAAGCTTGAAAATGGAGACCAACGGTGAACGCGGTTTCCAGGAGAGCATCTATATCTCTACGCTGCAGACAGTC
TGCTATCTGGTTTGCTTCCGCGGATTGGAGATTGCCACCAACGATGATGGTGCTGGCTACGAGTTTTTGCGTAGTCTCGGCTGGGAGAGACTACTGGTAG
CAGGTACCGGCTACTGTCCTTTGGCGTACTGCCAACAAACAGTGGCTACAGAGTTTCTGAATTTGGTCGAGACCTTCGACTTGGTCTCGGAGGAGTGCCT
CGAGCGTGTGGACCAGACTATTGGCACAGTCTCTGCGTTAAGTATCAAATCCGCCAAGTCGATGGAGCGGTCGAAGAAGCCCACAGCAGGATCGGCTCCC
GCTGCCACACTGCTTGGCCAGCGCCAGCCGCTTGAAACTTTCTTCCCTTTCGACCCATATCTCCTGCGCCGGTCTTTCCGCTACATCGGTCCGTTGTACC
TGTACTGGAAGCACGCAGACCCGACGTCGAGTGAAAACTGCGCACTGTTGGAGTCTGTCAAGTCCACCATTCACCAGATGCAGGAGGATGCTGAAGACGA
GGAGGACGATGACAGTGAAGAGGAAGAGGATCTGAGAGACGAAGACGTGAGCATGGCCGGTAGCGCGCCGAACCCAATGAGCCTTTCGAACGCTTCCTAC
CGCGCTGACAGCTATATGGGCAGCCTCAGCCGATCCCACAACATGTCAGTTGGCTCATCCTACGACGGTGAAGGATTTGGCGACGAAGATCGCGCACCGG
TAAAACGGACGCTGCCGTCGCGCACTATGTTCGATCCGTCCCCAGCTTTGTCAGCTAGCTCACCTCCGTCGCGGCTTCCTCCTCTTGGCTCTGCCGATGC
TTTCACGCTTGGGGGCTTCGATGATGACAACGAGGACGATGGATTCTAGGGAAACAATAAACTAAAGGAATAATGGACGTGGCATGAATGCAAGAGCTCG
AGTTACACCACGATGGCCTGCACCAAGAATCAAAGGATTGCAATAAGCTATTCAGCCACACGAGGGCGGTGAGTATACATAAGTAAAGTGAGGCGGAACA
AGTTGCAGCAAAGGCCACAGCTACCCAATCTCCAAGCCACTATCTCCAGTATCGACACAGTCTTGCTCTCAGAATTCGAACACGCTTGCCGTGACTGCGC
AGGGCGTCACCAGATTCAGCGCTCTACCGTCGGTTCAGCTGCGCGCGGAGTTGCTCGTTCTCATCCTCAAGACGCACGAGTTTGGGAACAACCTCCGAGT
CCACTTCCTCGATCTGGTTCTTCAGGTGGTGGTTCTCCTCGCGCAGACGCGAGACCTCTTCTCGGAGGTACGTGTTGATGTCGAGCTGCTGCTCCAGCGA
CGTCTTGGCCTCCAGCAGAGCGTCTTCCACCTCCAGCTGCTTCACGTGAGCCAAATCCGCTTGCTCTTGCACCATGCGGTTGCAGTCGTCCATGATTCTC
TCCACTTCCTCCTCTTTCTGGGCGATCTCGCTCTTCTTGGCTTCCAGTGACGCCTCGTAGCTTGTGATCTGTTCATGGCTGGAACTCACCTGCTCCTGGT
GCTTGTGTAGAGCCTCCTCGTTCTTCTCCAGCTGAGCGCGCAGCGTCTGCATCTCCAGCTCGTACTCCACCTGTCCCTGCTGTTGGCTCTGCGCGGCTCG
CAGCGTCTCCTGCTCGTTCAGCAGCTCGGTGATCATCTGCTCGTCCGCGGCGCGCTGACTCTTGATGGTCTGCAACGCCGACGTCTGGGAGCTCAGCTCC
TGCTGCAGCTTGACGAGCCTCGTGTCGATGACGCGGCGACTGGCCAGCATGTCCTCGTGCTGCTGCACCTGCCTGTCCTGCTCGCGCGCCGTCTTGCGCT
CGTCCAGCATGCCAGTGAGCTTGCAGATCTGGCCCTGCAGGAGACTCTTCTGCTCGCGCTCGAGCTTGAGCGCGTGCTCGAACACGGTGCCCGAGCGCTT
GGCGTCCTCCTCCTCCGTGAACGTGCGCACGTTGGGTGAGCGGCGACCACTCGCCGCATTGGCGCGCAGCCTCGTGCACCACGCGCACGCGGAACACGTA
TGTCTGCGTGAATATAGTGTATATAGAATAAGAAAATCTTCAAATAAATCACCCGTTTCTATAATAAATGGGTTGATAGGAGCCGTACCGTGTTGGACGT
GAGGCCTTTGACGGGGAACATTTTGCCCGTGACGAGCACGGACTCGTTCCACGAGTAGTAGACGTAGCCGTGCTCACTGTGGCTCTGCAGAACGGTAAGA
AATAAATGTTAAAAAATAATAAAAAAGGTAAATAAAGTTGGGGAACCGACCGCCTGCAGTTTGTACTGCGCCTCTCCGTCCGCTTGAGGCGGCTTCTCCA
CGCGCAGCGAGATGGACTGATCCGTCTTGGACACGACCTCCGGCGCTGGCAGCGTCGGCAGCTCTGGCATCACGGTGAACTGCATGGCGGCGGTGGCTTC
TTGATGCTTCTCGTTCTTCTCGTTCGACTTTCGCAGACTGACGTTTTGAAGCAACTTTGTTGGCTTCAAGCAACCGAAGCGCAACGTTAGCGCAACCGAA
GCGATGAAAGAGGACAGCTTGAGGACATGGCTACTGTACGGTGTGCTACAGGCAGATCGACTCGTCAATTTTCATGGTGTGCTCTTGCTTAAGGGGCATC
TTATTATCACTCGTCACCGCTGCCTTCCTTCCCTGCAGTTGCAGTTTGTTGGCTGCCCATTTACCAGCGCATGACGCGGCTCTGAGCGGGCAGGTCCCAG
ACGAAGGGACGGCCGGGCATGGGCGGCAGGTTCTTGGCCTCCATATCGTCGATGATTTCCTGCTCGGCATCGCCCTCCCACTCGAAGCGCACGTTGTGCG
TGGACGCGTGCTGCAGGATGAGCTTGTCGCGGGCCTCGTGGGTCGTCGACATGGCCGAGCGCGTGCCCGTGGGGTCGTAGCGCAGCACGGCCGGGTTCTT
GTTGCCGGGCGAGCCGCGCTTGGCGTCGGCCGGGATTCGGCGCGCTTCTGCACGGGGATGGACGGGTGCACGCCCACTTCCGTCGGGAAGGGGAAGCGGC
GGATGTCGCGCGTGTAGTAGCTGGTGTTGTAGACACTGTCCTTGGAGTCGCTGGAGGGGACGAACACACCCTCGGCCTGCTTGTCGGGCGACGGGTAGCG
GTAGCCCTGCGACACGGCGGGCGACTGGTTCACCTGCTTGGTGCCCGTGGCCTCCGTGAACACGAGCATCTTGCGCAGCTGGTGATAGCAACAGTAACAA
CAGTTAGCACGGAGGGGGATCATGGACGACCGGCAGGCGGCTTCACCTTGTTACGCAGCTCTGCAGGCAGCAGCTTCTGGTACTCGAACTTGACGAAGGG
CTTCCACGCCTCCTTGCCGCTCATGATGATTCCTCGCTGTCGTGTCCTGCACCCTCGGAAATGGCCCTCCAGCCGCACAATACGTCGTGTGTGGTGCACA
CCACAAATGTGCGACACATTGACACTTTT