Description :
From Genome Similarity Track
Location :
Scaffold_12:99662- 101167
Transcript NameFunction/comments
g4926.t1ETO82847.1 hypothetical protein F444_03068 [Phytophthora parasitica P1976

Sequence
1505 bases(100 bases per row)
CTGACGGCTGCGGTAGCGCTCCTCGTACTCGCGCTGCACCTCGTCCGCCGACTTGTTGGACGTCTCCGGCACGAGCTTGAGCGACAGCAGGAAGAAGATG
GCCAGCAGCACCACGAACGGCAGGTAGCTGTAGTCGTCCAGCGCGTCCGCGATGTACGGGTACGCCACCCCCACGATGAGGTTGCACAGCCAGTTGGCGC
CGATGCCGATGGAAGTGGCCGTGGCGCGCACCGAGTCCGGGAACAGGTCGGCCGTGATCACCCACACGAGCGGCCCCAGCGTCACGCCGAACGCGATCAC
GTACAGAGCCGTGAAGACGATGGACAGCGCTGGCACGTCCACCAGGAAGCCCACCGTCATGAGCACGGCCATGACGAACATGCCGGCGATGCCCCACAGG
ATCATGTTGCGGTTGCCGAAGCGCTGGGCCAGCACGCCCGTGAAGAAGGCGGGGAAGATGTTGATGAAGTTGATGATGAGCGTGCCCACGCGCGGGTCCG
AGATGCCGGCGTCCTTGAAGATTGAGCCCGAGTAGTAGAACACGGCGTTGATGCCCGACAGCTGCTGCGCGCAGGACAGCAGGATGGCGGCGGCCAGCTG
AAGGCGGTACTTGGGCGCGAACAGAGAGTCCTTCTGCGGGGACGCCTGCACCAGGCCCTGCTCGGCGTCCGGCTTGGTCGACGCCTCCATCCACGACAGA
GCCGTGTACACGTTCTCCTCGCCGTACAGACGAGCGATGACCTGCTTGGCCTCCTCGCGCCGGTTCTTCATGAGCAGCCACGCGGGACTCTCCACGCACA
GCTTGGGCGCCAGCACCAGGAACAGCACGGCCAGGATGACGGGGAAGGCCGCCAGGTAGCGCCAGCCAGAGCTCGTGTTGGCGAAGAAGAAGCAAATGGC
CGGGAACAAGATGCCGATGGTCACCGAGATCTGCAGTCCCAGCCCCAGGATGTTGCGCATGTGCGGCGGGGTGAGCTCGTTCGTGTAGGCGCCGAGCGTA
CCCGTGGCGGTGCCGGACGCGATGCCGGCGATCAGGCGGCCCGCGGAGAAGGCCCAGACGTTCGACACGGACGCCTCCACCACGGCGCCCACGATCATGA
AGGCGCAGTTGACGAACAGCAGCTTCTTGCGGCCCCACAGGTCGCTGAAGTGGCCGCAGACCAGCGAGCCGATCATGCCGCCGAAGATCCATGCGTTCAC
GGCGAACGTCCAATCCAGCTTCGAGTGGCCCGGGAACATGAGGCACGTGTCGTCGGCCACGGGACGCGCGTTGCACTCGTCGGTGTCGCTGTACTGCGAC
AGGTTGGTCTGCGACGACGACCACCCGCTCTGGAAGGGCTGCAGCAGCGCCACCAGGATGCTGGCGTACATGATGGTGTTGGGCTTGATGCTGCGGGCCG
CCGCCTTCTGCGCCTCGTCGAACGCGGGCACGTTGTCGACGCCTCTGGGCGTGGTGGCCTCGGAGTACACCGGGTCGGTCTGCGCTTCAGACGGCATGGT
GGGTG