Description :
From Genome Similarity Track
Location :
Scaffold_649:9966- 11643
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_649-fgenesh-gene-0.2Serine protease family S10

Sequence
1677 bases(100 bases per row)
CTCATGACCTTCCCTCCTGTACTGTAGTTCGTGTCAGCCCACTCAGTTGAGCACAAAGAGGTCGAGCATCTTTTTGGCCGCAACAGGCTTGACCTGTGGC
ACGAGATGGCCAGCGCCCTTGACAGTCACGTACTTGAGCGTCCCAAAGTCCTCCAAGAACCCGGCCGTCTGGTCCGCTCCATCCGCGTCTTTCACAGTCC
AGATCGATCGCGGCTGCTGGCGCGGGAGCTGCAACGACTCTACCGCCCACAGGCCACCGATGAAGTCGCAGACCATGTCGGTGTCGCCGTGGTAGATGAC
GGCGTCCACGCCATGGTCCAGCAGAAAGGTCCAGAGCGGCCGCACGACGGCGCCCAGCGTGGCCTCGTAATCGAGCAGCGTGTGCTGCTTCATGCCGGCG
GCTACGGTCGCGTTGACGCCCATGAGCTTGCCAAAGAGATCGAGCGACGTGGTCGTGAGTGCATCGCCACTCCAGCGGACGATCGCTGGGTTCGTGTGCA
TGGCCGTGCGGACACTGGGGAGATTGAAGTAACTTTCCACGTGCCGCGCGTCGAGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCCACACAGGCGCCGTAGATGTCGTACGAGTT
GATGTGGTACGAATACAAGCGCGTAAACACGTCGAGCATTGCGACCGCACACGGCGACGTGAGGTCGCCCCCGAGAAAGGAGTTCTTGCTCGGCTCAAAC
TCCTTGAAATCGGGGCAGCTCGAGCGCACGCGCAGGTAGTCTTGCGTGCTCAGGAGACCGTGGTAGTAGGCGTAGAGAATCGCCGAGAGCCCGCCGAACT
CGTTCACGCCATTGCCCACGACAAACTTGGTGAGGTTAATCTTGGTCGCCGTGTCGTTCTTCTGGTTGCCCTCGACGATGCGCTTGGCCGTGGTCGGCAC
GTAGATGCCGCCGTAGCTCTCCCCACTGATGATAAAGTCGTTGGCACGCAGCGCCGGGAACTTCGTGAAGAACGACTGCAGCATCCAGTAGAGTTCGTCG
GCCTGCGCGAGATCATCGGACGCGTAGACACCGCTGGCGTTGTAGGAAAAGCCCACGCCCACGGGCGACTCGATGCAGAGAATGTTGGCGTCCTTGTTCC
ACGCATAGTCGTTGACTCGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
CCCAGAGAGTGAGCTGGCACCGGGTCCTCCATTCAGCCAGAGCAGCACGGGGTCGGCGGACGCGTTGGCACTCTGCGACTCGGCGAAGAAGTAGAACGCC
TCGCCGCCGTTGCCGACAGGGAGGTACCCCGAGAAGAGGCGCGACGTGTACGCATCGGGCTTGCCCGGGAGTGACAGGATCTCATCGGCAGCGCCACGGA
AGTCCGCCTCGGAGCTGACAGCGCGACTGGTCGTGGTCGTGCGGAGCGGGGACGGCTGCTGCTGCTGGGAGACGAGCAGGCTGCCAGCGACAAAGAGCAC
GGCGACGCCCAACGCATAGAGCGCGAGCTGGCGGCGACGAGAGGCGACGCGGTAGCGGAGCGGCACGTCGCCGATGG