Description :
From Genome Similarity Track
Location :
Scaffold_186:99640- 100685
Sequence
1045 bases(100 bases per row)
GATGACTCGTTTGTGTCCAGCCGTGTCGGCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGTTTCGTCTCGTCC
GGCAGGGCCAGAACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTTGTGCTCCTGCTCCAGCGCCAGTCGACGTCCTTCTGAAGGTG
GCCCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTTTGGGATCGGGGC
ATCGGCCATGCTGCTATGGTCTTGACCTTGTCTGGATCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAA
CGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATTACGTCCAACACTCGACGGAGGTGCCCCAGATGCACCTCCATGGCCGTCTTGCTTCCCTC
GGCACGGCTATGGATGAATATGTCGTCGAAGTACGTATGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCG
TTAGACAGGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGAAGTGCTCACCACGGTGAGTGGGATGTCACTCTCTCGCATCAGGATCTGGT
AGAATCCGTCTACCAAATCCAGCGCACTGTGCAGTACACCTCCAGTCATGTGGTTTAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGT
TGCGTTGTTCAGCTTGTTATAAGCATGAACTAGACGCCACTTTCCGTTCGGCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGC
ACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGTCATTGCCTCGTGACACAATACTTTGTGCCAG
GCACGAGATCAATCCCATGCCGTACGTCTCGATCCGGTGGGAGTT