Description :
From Genome Similarity Track
Location :
scaffold_189:9962- 12797
Transcript NameFunction/comments
g5354.t1 callose synthase, putative

Sequence
2835 bases(100 bases per row)
TAAGATCACGCGTGAGACGTTCGTGCTGCTGTACAAGGCGTACGCCAACAGTCACTACCGTAAGGCTATGGAGCTCGTTGGATTGTGTCTGGTGTACTTA
ACATTCGGCAAGTTCGACATTTGTGACACCTCAGTGGCTGGTGAAACGAACTCGTTTGCCTTTGAATACTGTAAGACGTCGCAGAGCTTCGGTGTGCAGA
CATTTGCTATCTGGGTGATCGCAGTGGTGTGGCTGGTGTCTCCGTACATCTTCAACACGGACGGACTCGACTGGGAGAAGACCAAGGCCGATGTGACGGC
CTGGGCCAAGTGGATGTACGCTGCAGAGGACTACAAGGACGAAGACGCGGTGATGGTTGGCGGATGGATTGGCTGGTGGAAGGGCGAGCTCAAGCTGTAC
CATAACACGAAGCCTATTGCTCGCTTCACGGTCATTCTGCGCGAATGCCGCCACTTCCTGCTCATGTGGTACGTGGTGGCTCTCGAGTGGGAAATCCTGA
CGGTCGGCCTGGTGTTTGGCGCCTCCGTGGTCACAGTTCTGGCCATGGGTCTCTTCGGAGCTGTCGGCGCTACTATGCGCAACATGAAGGCGTCGACCCG
CGCGATCCTGTACACGTTTGTGGTGGTGGTGGCGCTCATCGCGTTCTTCGTGGTCACGCTCGTCATCTCTGACTTGAGCTTTACTCGTGCGATCTCTCTG
TTCTTCGGCTACATGGCTGCTCTGTACGGAATCAACGAGATGGCGCGCATGTACAGCTTCGCGAACTCGGGGATCGCTACCGTGGGCATGTTCCAGCAGT
TGGCGTTCTTCTTCGACTTTGTGTTTGCGGTGGCTATGATCGCCCCGCTTCTCGTCATGTCGGCGATCCCGTTCCTGAACATTATCCAGACGCGTATGAT
GTACAACAAGGGCTTCTCGGAAGTCGTTTCGGCTTCGTCGCAGTACGCCTTCTCGCTGGCCGCCTTCATGGGTGTGCTGGGTGGCATGGGCTGCGGCTGG
CTGTTCCACTTGTTCACTACTCTTGAGAGCACGGCTGGTTTCCTGAGTTACGTCACGACGTACGACCTGTTGGACGGCAACGTCGGGGACGGCTCTGTGA
CGTACGCGTTCTACTTCGCCAGCATGGTGGGCACGTTCGTGGCCGGTTTCCTGAACTACTTCATCGGCCGTCGACTGTCGATCGTCTTTGGCGGGTTATT
GACTGTTCTGGGTATGCTGGGCGTGAGTGCGGTGCAGACCGGTGGTGAAGGCTTCCTGATGCCTGGTATTTGCTTGCTTGGTGGCTCTGTGGGTGTGCTG
CTGCCGACTTTGGCTGTGTACATCTACGAAATTTCGACCCGTGATATGCGCGGCAAGGCGCTGTTGCTTCTTGGCAGTGGCTTCATCTTGGGCATCTTGT
TCGCTGCCTGGTTCTCCTCGTCGTCGAACGAGGTCGGCTGGGTGTGGCAGGTGTTCATTGCGACCATCATCCTGTCGATCATGACCCCGGCGGTCTACAT
CTTCCCGGAGAGTCCGTACTGGGTGTACATGCGCGAAGGTTTGGAGTCGTGCGAGCGTTGTCTGGCGGTTCTGCGGCGTAAGGAGGGAGTGTCGGAGGAG
CTGCGTATGATCCGCGACGAAGAGGCTGGAAGCGACGACTCGAGCGCCAACGGCGGCACGTCGTTCCTCAAGTTCATGATGGGACTGTTCCTGATGCTCG
TCTCCAGTATCTTCCTGGGCTGCGTCAACATGTACCTGTCGGACACGTTCCGCAGCATCGAGGACGCGACGTACATGTTCGTGAACTGCATGGGCTTGCA
GTTCCTGGGCGCTCTCTTCTCGTTCTTCTTCATGGACCGCATCGACCACAAGCGCATCCTGTTCTGCACGTTGCTGCCTATGGCCGGACTAGTGTTCGTT
CTCGGACTGAACGACAAGTCGGAGTTCGTGACGGGCGACAGCAAGTACTTGTTGCTGCAGATCGTCGGTTTGTTGCTCTACTTCTTCGCTGGACTGGGAA
TCACGTCTGTTCCTTGGGTGTCGTGCGTCGGTCTGTTCACCACGAAGCAGCGCGCAGTGTATGTGACCGTCTACTTCATGGTGTTCTTCCTGTTGCCCGT
GTGCGCCACGTACATCCGCTCGAACGAGTCGATGAGCGGTGACCAGTACATCTACCTGTTCGCGTTGACTGGCTGCTGTGTGGTGGCGACGGCGCTTCTC
TTCACTGTGGGAACCCTCAAGAACGGCATGGTCTGCACCAAGGGCGAGATGGAGGCCGAACGCGCGCGTCTGCGTCGCATCCGGGCATCCCGTCGCAGCG
CCCGCACGCCCGGCAGCGCGCGCTCAAGGAACTTCAGCCGTTCGCGCGCAAAGTCGCACTCGAACTACCAGATGTACGAGTCGCCCGCTGGCAGCGCGCC
GTAGACTGGTGCTAGGCTTTGGCAAGATGCGGATTGTACTCTATCCGAGTCGCTCTTGTTTCACATGCATCTTGCTTTTGCTTTTACTTTACATGATAAT
CGTTAATTCAACGAAAGTTTTTCCATAACTCCTGAGCATCTTTTCACAAGAGATAAAGTTGGCAAGAAGATGATAAAGTGGTGAGAAGATGAGTGTAGAT
GTGTATGTTGTCTAACGTAGCGTCTGGTTGTCTTCAACTTCAGATTGAGCCTAACAACGCTTCAACCTTTCTGAACTCTTCAACTTGTGTAAATGAGCAA
CGCTTTAACACCAAGCCACTACAGTATTCCCAAAACTTTACTGTTTCTTCCATTGGCACTTATCAAGTGCTCCCTTTTCTTTTGTCTGCCTGCGCGCTCC
GGCACTGACGTGAGCTCCCCACGCTGTTAAATTAT