Description :
From Genome Similarity Track
Location :
Scaffold_499:9962- 11239
Transcript NameFunction/comments
Phyag_g6196hypothetical protein PHYSODRAFT_493381

Sequence
1277 bases(100 bases per row)
CACCTGCAAAATCCCGCTTGCATTCATGGTGAAAGTAACGGGGTGTGTGAACTCGCCCGCCTTACCAATCTTGTCCCATGGCAGCGCAAAGTTGAAATAG
CAGATGTGGTCGTTCTCCTTAgcaatctccttctcgcctTCGTAAACCTCAACGGTGAGTCCGCGCTGATCGTCCTCATAAGTCTGGAAATGtttcgtca
ccgtcgtcggGATGCGAGCATTTCTAGGGAGGATCACCTCCATGGTTCCATCCGCAGTCTCAAGTCCGATTGGTAGCGGAAGGACGTCCATCATGAGAAC
GTCGCGGAACACGTGCTGATCCAACCCACTCAAGATAGCTGCTTGGATAGCAGCTCCCTCGCACACCACTTCGTCAGCGTTCACAGACATACAGAGCTCC
TGAAGCGCATGAAAAGCAGTAACATTGGTTAGTAGTAGAACCTAGACCcactgcatcaacaacagcacaACGCACTTTGCCGTCGAAAGCCTCTGAGATC
TTCGAACGCAAAATCGGGATCCGCGTGGATCCTCCCACGAGGATCACTTCGTCAATGTCGCCAGCTTCCACCTCTGCTTCCTTCAGCACACTCGACACGA
TCCGAAGGCACCTTCATCAATACACAACACCAATACCGTAAGTGTCAACATAACTATCCACCCACATCTCACACAGGAGCTTACTTCTTCCAGATCGGGT
CGCATAGTAGCTCAAATTTGCGTCGCATCAGCGTGTACGTGAATTTCTCCACCCCCGCAACATCCAACACCTCAATATCCGCATACTCCTCTTCCGACAG
CACaatcttggccttctccacctcccgTTTCAACCTCACCATACCCTCTTCCCCCACTTGTGCACGGGTCACATCATGATGTTTATtcaacacctccagc
aaaTGATCCACCAGGATATTGTTGATATCCTCTCCTCCCAGGTTCGTGTCTCCTCCAATGCCCAACACCTCAAACTTCCCGTCTTGAATACTCAACAACG
ACACATCCAGAGTTCCTCCTCCAAAGTCAAAAACCGTCACCAATTTCGTGCCCGACAAGAACAATCCGTaggccatcgccgccgccgttggTTCATTCAG
CAGCCTCACAGCCTTAAATCCAGCCATAGAAGCACCGGTAATCGTGGCTTTCCTCTGAGAATCACTGAAATAGGCCGGGACTGTGATCACCACATTGTCA
AAACTGGTCTGGCTGTCAAAATAGGCTTCGGCCGAGGCTTTCAGCTCGGATAAAACACAGGCCGAAATTTCTTCAGG