Description :
From Genome Similarity Track
Location :
contig_26:99613- 106342
Transcript NameFunction/comments
g6726.t1hypothetical protein
g6727.t1KUF84696.1 hypothetical protein AM587_10008529 [Phytophthora nicotianae

Sequence
6729 bases(100 bases per row)
GATCACTAGGAAAGAATTCCGACAGCTGTATTATCTTGTTTACGGAGTATATCCATCCTACTCGTATTTCGTGTCTACCATTTCGAACCCAGGATTGCAA
CAAGAGAAGCATTTTGCTAAGCAGCGGGATGGTGCACGCTAAGACGCAGAACGAACGTTCGGTGTACTGTAAAAGCGTTTTCGTATAGTAAAGATGCCCA
GTCAGATTTGGTATCCAGAAGACATGCTCTCCGTCATAAAAACATTTTGCGCAATATAATCATCGAGGATGAATGGGAAGTTGACGACTTGGATGAATTA
CCAGAAGAAGACACACACGTTGATACGACGAGTCGAGTGAGGAATGACGGTGTCCGTGAGAGAGAGGAGCAATTGGCTGTGGGTGAATAATCACGAGACG
ACTCCAAATACAACCCGAAATTAACCATCTAGTGCTGAAAAGATCTCTCATTGATCACTTGTGGGGTCTGAAAGGAAAGCAGAGTACGTTAGTGCAAATA
CTTATAATCCACCAAAGTGATTCTACGTAGCTTACCCGCAGGCAAAGAGTTTTCACCATCTGCATTGTTCTTGTCAAGGTATCCGACACCTCCAAGTTCA
TGAGTATCCACCAGATTACTTTGTTACTCCAGTTGCTCTTAGACGCGCCGCTCTTCAGGCGAAGAACATGCACAGAGTCCTCATCCCAGCCGTCCAATTT
GGCGGAACTTATTTTGTTCTGTTCACACTATTGCAAAACCGAAATGCGTAGCTCTTCCAGTTCTGCCTTACGCTTCGAAATCTTGACCATCTCCATAGCT
GCATCTGCCATCTGTCGGTTGCTTGCTTCTAGTGAGCGCACAGCCGTTTGCTTCTGGACACCAGCAGCTCGCTTTGATATATCTTGTGTAGTCGTGTCCG
TAGATAGTGACACCATGCTATCGTTGTCATCACCATGGGCAGCCACGTGCTTTTTACGGGCTCGCAGGTAGTGTCAACCTCTTCGGTCGACTATGAAGTT
CTCTCCATCCTTCTAGGTGTTTGAATGGGGTATCCTGTTTGCTCTCGTACATGGTTACCGCGTCTTGGACACGACCCTCATCGGTTTTACCACTTTCGTT
GAGCTGTTTGATGGCTACAACATACCCACAGAACTTACCCACTGGTGTGAGTCCTACGACGAAAATTGAGAACTGATTGAAGAAAGATTATCCTGGCTTC
TTGCTAACTACCGATGCAGTGTCCTTGACGCTAGAGAGGGGCACACCCAGTGTAGAGTTTCAATTGAACCCATCGACGAAGGGTTTTTACGCAGACCCCA
AATGGCGATTTACTACCAGGAAGAGTCTTAATGTACGTCTATCCTAGTTTGGTTCCTGCGGTGGAGAGAGGAGACCGTAATTCATCGAATAATTTGCTGC
TGAAACCTCAATTTTCTACCGCGGTGGAGACACCCTCATATTTCGGGCTAGGACAAACCCAATCTAGCGTTTTCTCGATGGATCTAACAGATCGATCGAT
CTACCTCAAATCGATCCCTTTTGCATTTTTGAAAACGCAAATCGATCTATTTAATTCCAAATAAAATACTGGTTTAAACATGTATCACATAACTTTAGAC
CACCGGAATTCCGTCTAAGTACGATCCATTTTCACCCGCTCATTTGACAATTGCGACCACCACGACTGCATCAATCAATGGGAGCCGCCGCCAGCAAGAC
TTCTTCGTCCGCCGTGGCGCGCACCCGTGTGATCCGCACCAACGTGTCTCTGGAGCAGTTGGTGGCGCTGTCCCGCGGCGGCGCAGCGTCGGACCTGCCG
TCGCAGCCCTCGGGCCTTGCCGTGGAGACTTCTTCGACAACCGTGGACGCGCACGGCTCTGAGGTGGAGCTGCTGGAGATGCAGCAGCAGTTGCTGCAGG
ACGTGCAGAAGATAGAGGACTTCGATCGCGTCAAGTTTCTGGAGGAGAGCACGCGCGCCTTCGAGGCCACCGCCAGCAGCCACCGCCCCAGGTCCTCGCA
GCCCGTGCGGCTGCCCACCGACAAGACGAGCGCCGCGTCCTCCACGGGCGTGGGAGGCGCCGACGAGCAGCAAGTGCGCGGCCGCCTCACGACGAGGGAC
CTGCGTACGCTGCTGCGGCTCCACTACGAGCAGCCCCAGAGCTGGACGCACGAGGTGCTGGCCGACAAGTTCGGGCTAGACGCCGACACCATGCGCTGCA
TCCTCAGCAGCGTGGGCCCGCCCAATGTGCTGCCGCCCAGAGGCACCTCCGAACACCCAATGGGCGTGTGGTTTGACGCCCCGGGTTTGCTGCCAGTGAA
ATCCGAGCTGCAGTAGAGTCGCTCATCCTAAACGTAAATCATAATATGCTAGACAAATGCCAACGTAGTGCTGTCATTTTCAATATGTCGGGAACTTTGC
TAGTCAGCATGGCACCCAAGCCTTCCTGCTCGCTCATACTCATAGGTCGGCGGCACCTAGTTTGTGAAGTTGCCTTGCCTTTTGTACTATCGAAGCGTTT
CTGTCCGGGCCAGTCGTTTCTCGACCCACAACGGAAAAACTTAGAAATGGCTGGAAGCACAGCGTCGCTGCCCTCGGCGCTGCCTGTGGCGGCTTCTCCA
TCGGAGCAGGAGGTGGCCAGCATGCAGCACTTCATCGAGAACGCGCTGGACCTGCTCGTCAAGGTAAAATCTCCTCTCCACAATAAAAAGACCCTTAAAA
GACTCACCCATTTCCATCTACTTCCAGGGCAACGCCAAGAGCTACGACTACCTCCTGCAGCAGCTCACGCTCGCGCCCGCGCCCGTGGCCACCAGACGAA
AAATCTTCCGCGCGTTGCCACGCTGCATCTCCGCCATGGCGCGCGAGCCCAGAGCCTACCGCGCGCTGCTGGACGTGCTTTTCAAGTTCGACATGTTGGC
TAGTGGAGACCCACTCGAGGTGGACGACTACACGAGCTTCGTGGTACACCTCGTGTCGTCCAACACGGTCTACGTGGTGCCCACGCTGCACATGCTGGTG
CGCAATCTGCGCCGCCCGCAGACGAAGGAGCTGCCGCCGGATCTCAAGGCCCAAATACAGGAGCAGGAGACCCTGAAACCCGTTAAAACGGGTGCAATTG
CCATCGGAGGCTCTTTTGGAGCTGACGTCGCTGCAGTGCCAACGCCCCTGGTGGAACCCAAGGCACCGAGTCTGGACGAACGCATCCAGGCGCGCTTCGA
AGCGGCGCACGCCACGCTGGAGCGCGTGTTGGCACTCGTGCCGACTGCTACGAACGTCCTGTTCCCGATCTTGTGCGAGCACTTCCCGCACAAGCGGATG
GATGCACCCACCCAGGTGGCGTACCTGCGCAATGTGCTGCGCGTGACAGGATACGTGAGCGGATTGCGTGAGCGCGTGTTAGGGCTTGTGATCGACCAGC
TAGTGGCTATCGACGTGGAGATCAAGCTGGACGAGAGCGAAGAGGACGTTTTCACCATGGATGATTTCCTAGACGATGATATGCTACCGCCCGATGATGC
ATCGCGTCAAGTGGACGAGATGGCTGACAAGCTGGACCAGATGATGCTCGTCATGTTCGAGCACATTGAGCACTCAGCTGCATCTTCGTCACCCGCATCA
GTTGAGACGGTGGCTCCCACTGAGACTAGCAGCAACGAAAAGGATGTGAATGTGCGTCAGGCGGCATTGATCTTCAAGCACCTGCTGAAGGTTTTCGAGC
ACTCCATCTTGAACACACATCGCTCCAAGTACCCGCAGTTCTTGCTGTTCTACGTGTGCCGAATGGACCCACAGTTCCAGGACGTGTTCATCTCGCAGTT
GCTGGCCACATCGCTAGACCCCCACACGCCGCCTACTACGCGACAAAGCTGCGGCGCTTACCTGGCCAGCTTCCTCGCTCGAGCCAAGTACATTTCCGTG
GCTTATCTTCAGAAGGCTCTATATCACTTGTTGAAGTGGCTGCATGATCAGATGGATGTCTACGACGCGGTACACCAGGAACAAATGGACCAAGACGAAG
TTAGGAATGGCGAAAGTGCTGCTGAAAGAGAAGAGCGCCTGCTGGAAGAAAGCTTGAAAATGGAGACCAACGGTGAACGCGGTTTCCAGGAGAGCATCTA
TATCTCTACGCTGCAGACAGTCTGCTACCTGGTTTGCTTCCGCGGATTGGAGATTGCCACCAACGATGATGGTGCTGGCTACGAGTTTTTGCGTAGTCTC
GGCTGGGAGAGACTACTGGTAGCAGGTACCGGCTACTGTCCTTTGGCGTACTGCCAACAAACAGTGGCTACAGAGTTTCTGAATTTGGTCGAGACCTTCG
ACTTGGTCTCGGAGGAGTGCCTCGAGCGTGTGGACCAGACTATTGGCACAGTCTCTGCGTTAAGTATCAAATCCGCCAAATCGATGGAGCGGTCGAAGAA
GCCCACAGCAGGATCGGCTCCCGCTGCCACACTGCTTGGCCAGCGCCAGCCGCTTGAAACTTTCTTCCCTTTCGACCCATATCTCCTGCGCCGGTCTTTC
CGCTACATCGGTCCGTTGTACCTGTACTGGAAGCACGCAGACCCGACGTCGAGTGAAAACTGCGCACTGTTGGAGTCTGTCAAGTCCACCATTCACCAGA
TGCAGGAGGATGCTGAAGACGAGGAGGACGATGACAGTGAAGAGGAAGAGGATCTGAGAGACGAAGACGTGAGCATGGCCGGTAGCGCGCCGAACCCAAT
GAGCCTTTCGAACGCTTCCTACCGCGCTGACAGCTATATGGGCAGCCTCAGCCGATCCCACAACATGTCAGTTGGCTCATCCTACGACGGTGAAGGATTT
GGCGACGAAGATCGCGCACCGGTAAAACGGACGCTGCCGTCGCGCACTATGTTCGATCCGTCCCCAGCTTTGTCAGCTAGCTCACCTCCGTCGCGGCTTC
CTCCTCTTGGCTCTGCCGATGCTTTCACGCTTGGGGGCTTCGATGATGACAACGAGGACGATGGATTCTAGGGAAACAATAAACTAAAGGAATAATGGAC
GTGGCATGAATGCTAGAGCTCGAGTTACACCACGATGGCCTGCACCAAGAATCAAAGGATTGCAATAAGCTATTCAGCCACACGAGGGCGGTGAGTATAC
ATAAGTAAAGTGAGGCGGAACAAGTTGCAGCAAAGGCCACAGCTACCCAATCTCCAAGCCACTATCTCCAGTATCGACACAGTCTTGCTCTCAGAATTCG
AACACGCTTGCCGTGACTGCGCAGGGCGTCACCAGATTCAGCGCTCTACCGTCGGTTCAGCTGCGCGCGGAGTTGCTCGTTCTCATCCTCAAGACGCACG
AGTTTGGGAACAACCTCCGAGTCCACTTCCTCGATCTGGTTCTTCAGGTGGTGGTTCTCCTCGCGCAGACGCGAGACCTCTTCTCGGAGGTACGTGTTGA
TGTCGAGCTGCTGCTCCAGCGACGTCTTGGCCTCCAGCAGAGCGTCTTCCACCTCCAGCTGCTTCACGTGAGCCAAATCCGCTTGCTCTTGCACCATGCG
GTTGCAGTCGTCCATGATTCTCTCCACTTCCTCCTCTTTCTGGGCGATCTCGCTCTTCTTGGCTTCCAGTGACGCCTCGTAGCTTGTGATCTGTTCATGA
CTGGAACTCACCTGCTCCTGGTGCTTGTGTAGAGCCTCCTCGTTCTTCTCCAGCTGAGCGCGCAGCGTCTGCATCTCCAGCTCGTACTCCACCTGTCCCT
GCTGTTGGCTCTGCGCGGCTCGCAGCGTCTCCTGCTCGTTCAGCAGCTCGGTGATCATCTGCTCGTCCGCGGCGCGCTGACTCTTGATGGTCTGCAACGC
CGACGTCTGGGAGCTCAGCTCCTGCTGCAGCTTGACGAGCCTTGTGTCGATGACGCGGCGACTGGCCAGCATGTCCTCGTGCTGCTGCACCTGCCTGTCC
TGCTCGCGCGCCGTCTTGCGCTCGTCCAGCATGCCAGTGAGCTTGCAGATCTGGCCCTGCAGGAGACTCTTCTGCTCGCGCTCGAGCTTGAGCGCGTGCT
CGAACACGGTGCCCGAGCGCTTGGCGTCCTCCTCCTCCGTGAACGTGCGCACGTTGGGTGAGCGGCGACCACTCGCCGCATTGGCGCGCAGCCTCGTGCA
CCACGCGCACGCGGAACACGTATGTCTGCGTGAATATAGTGTATATAGAATAAGAAAATCTTCAAATAAGTCACCCGTTTCTATAATAAATGGGTTGATA
GGAGCTGTACCGTGTTGGAGGTGAGGCCTTTGACGGGGAACATTTTGCCCGTGAAGAGCACGGACTCGTTCCACGAGTAGTAGACGTAGCCGTGCTCACT
GTGGCTCTGCAGAACGGTAAGAAATAAATGTTAAAAAATAATAAAAAAGGTAAATAAAGTTGGGGAACCGACCGCCTGCAGTTTGTACTGCGCCTCTCCG
TCCGCTTGAGGCGGCTTCTCCACGCGCAGCGAGATGGACTGATCCGTCTTGGACACGACCTCCGGCGCTGGCAGCGTCGGCAGCTCTGGCATCACGGTGA
ACTGCATGGCGGCGGTGGCTTCTTGATGCTTCTCGTTCTTCTCGTTCGACTTTCGCAGACTGACGTTTTGAAGCAACTTTGTTGGCTTCATGCAACCGAA
GCGCAACGTTAGCGCAACCGAAGCGATGAAAGAGGACAGCTTGAGGACATGGCTACTGTACGGTGTGCTACAGGCAGATCGACTCGTCAATTTTCATGGT
GTGCTCTTGCTTAAGGGGCATCTTATTAT