Description :
From Genome Similarity Track
Location :
Scaffold_389:9961- 15261
Transcript NameFunction/comments
Phypl_g7740hypothetical protein
Phypl_g7741hypothetical protein

Sequence
5300 bases(100 bases per row)
GCGCCGTGGTGTCCACACCAATGGAGCCCGACACAGTCGTTTGAATCGACTggccctgctgctgctgttgctgctgctgctgctgctgctgttgctgctg
ctgctgctgctgctggccgctcgtgctggggGTGGTCTCGGTCGTCTGACCCCACGTGCCGGTGGAGCTCTGGTCTCCCGAACACGGCGTGTCAGCGGGG
GCACCACCCTGGTTCGTTGTCGTTTGGCCCCATGAGTTGGACTGTTCTCCTGCCGTAACCGTTCCAGTCCAGGCGTTGGTGTCTGTGTCGGATTCACCGC
TGGCGCAAGGAGTCTCCGTGGAGTCTCCACCCTGGTTGCGAATGGTGGAGCCCCATCCTGTCGCATCGGTTCTGGCCTGGCTGCCCCGGGTAGTGGAATC
cgtcgttgaagtggagGGAGCCAAGGTAATAGTAACAGTGCTTGACATCGTCGAATCAATCGACGGGGAGTCCGTAGTcgagctctgctgcgtcgtcgag
tcactcgtggtgctggtagGCGAGTCTGTCGACGGAGACGTTGTGGTGGTCTGCTGGGTCGTGTAGGAATCATCGCTCGTGAGCGAGGAAGTCGTGGTAG
TGGACGACacaccgccaccgccgccaagctTCCGCGCCGCCGGGCCATTAGCTGCGACGGAGGCGTCCGCGATGGAGGTcacggccagcgacgcgagcgt
CAGGAACGCGACGATTTTGCCGATCTTCATCctgcgacgagaaggaggacgagtgCGGAGAGGAGGTAGCACGCtcacgtgctggaggaaggaACGATGC
TTGTTGGCGAAGCAAAGTAAATTGGGGAATGGCCCTGCCGACGTCGGGTGCCCCCCACGAAGGGCCATACACATGGCACGCTGACGATGTGCCGTGCACA
CACACAtttggtcgtcgtcgggtCACAGGATGCGTCATGCATCgatcgccagcagcaaccgctgcgCAGCGGTGAGGGATATCCTAACCTTGTCTAGGCA
CTGACAGGCATCACCAACTGGCGGGCGCGACTACTCTCCGGTGGATGCAGTAACGACGGGTGGTCACGCTCGTGCACCCGAACTCCGATGACGAGGCAGC
GGAGACCTGAGATCACCCGCCGAGACGCCCACACCGCCATTGGATACTTGCGGAGCCTTGACGTTCCAGCTTAAGCCGGTCGGCAAGCGACCGTCACCTG
GTAGTGCGCACGCGTGCAAGTGTGGCTGGGAGCTTGGTTACCAAGTCCTGGTGCCCCTGACTCATAGATCACCGACCGTATCAACAGGCCCGACCAGCGT
GCTCCCTCCTCTACACTGTGCGGACGACGGACGGCGTACGCGCGCGGACTTCAACGATCTCCACCTGCGATACAGATACCGCCGGCGCGGCAACTTCAGG
AGGTTGGTTATACGGAAACTCGTTCCGGTTCATGTGGTCACCACGCCTGACACACGCCGCAATGCGCGCCGTCCGCCAGCTGTAGGGTCGAACAGCCTAC
ATGTATGACCCAATCGACGAGTCAGATTTTGTCGCAGTCTCGATCATCCCATTCCGATCCGTATTgccatgaagctgctcgcctgGATTTCCCTCTCGCC
TTTACTGACTCCGCGCGTGATGGAGGTGCGATCAACTCCAGCtcaccacgacggcgaccaGGCCTTTGCCTTTCAGCGCAGTAGGATACATATACTGTAC
TCCATACCAACATGCTTGAGTCACCAGGGCACGCCTCAGTAACCTGGCACTGCGAGGGGGGTGCAATGCACGCCACTTCAAAAACAACACGGAGGCTGGA
CTCGGGATACAGCTGACGGCAATCGCATCGACGTTGGCCCATTTCGATCCCAGCAGCAGGGTGGCTACAGTATGTCTTCTCCAAACCAGGAAGGTGCACA
CTGCTGGTGTCGGAGCCAATGGTGCCAAGGATATTGCATTCCCAATTTAGCTGGCGATTCCACTAGGACAATGACCGCAAAGCGCCATGGACTCCGGTGC
AACGATCCTTCTGCGTACAAAAAGGCAGTTTGCAGTGATTGGATTGAATGCCTATTCGGACGTCCGTGGCGTTGGGTTGCCATCCACCGCCAGTGACACC
CAACTCGGCCATTTACAAAACCCAGAAGCCCAGCTCTCACCGCATAGTAGCGCGCAGCGCGAAGTGAAGACGCTATGTCGTACACCGAAATGGTCCGTCT
CGGTCGCTACGTTGTAACGCTATGCTGGTCGACAACGTGCTGATGGGTGTGCGTGGATACTTTCGCTCAGCTTGGCGCCACGCTGGCCTTTACGAGCCTC
GTACGAAGACACTGGAGCTGGCAGTGTAGAGTTCACGCGGGGACTCGCCTTCCCAGTGAAGGTTCCCACATGGGATCCCGTCAGAACGCCCGACAAACCG
AACGTTGCTGCGAGCGGTCCTTTTTCAGACCCTCGTCGAAAATTTAACCAGTCGGTAGTCCTCTACGCCGGTACAGCATGCACTGCAGACTGCAGTGCGG
GACATGAGTGTCAAGTGCCAAGTACGTTTCTGTCGGGCAGCTCCATATGGACTGTGCGGCGATCTAAGTCGATTCAAAGCGACCCGACTCAGTTTTCAAG
GCAAGCGCCAACAACTGCAGTGAGACCAGCGGTGTAATAGCACGCATCTGCATCCGCACACAGTGTGACACAGCTGCCAGCTCGAGAGGCACCCACCCGG
TCGGTAGCTCATTCGCGGTGTCAATTCCCCTGCAGAGCAATATGTCAGCTCGATCGTAAGCAGTTGCTCGGATGTTCACATCCGTCCGTGTGCTGTTTTG
AGTTAGACAGCCCTTCTCAGGCTGACGCTTGCTTGCTACTGGGGACTGGGTGACcgacgtacatgtagcagaGTACGGGTGACGTCCGGGTTCAACTGCA
GTCCCACCCGACAGATGGCAGTCTCCGAGCATATCACTGCAAAGGATGTTCGCAATGAACCCGATCCGCCTCTCGGTGTGGTGTATCTCGCTGCACTCTA
GTCGCTGTTGGGATGGATAAACCCAGCTCTTGAGTACGGACTGCACGGCGATAGCTCATGAGCCCGACAACCGTTGGTCGGTTAGTCATTCTTCAATTTA
CTTTGCACTCCGCAAGCAAAAACAGCCACACCCGAGCGCCCAAGGTTGTTATCTCTGCCACTAGCTCAATTCAGCAGTACGCCACACTTCCAGGATGAAC
CTCAGCAAGATTTTCACGCACCTCGctttgctgtcgctggcctTGGGGTCTCTCGCGGACGCCTCCGCCAACGTCGTGGCTCCCGACACGCGCTCGGTGG
TTCGTCAGAACAACGCTCTGCGTAACCTGAAGGCGGCCGGCACGGGAACTGGCGTCACCACGAGCACCTCGTCCGGCGACTCGtacaccagcaccacgag
tGACTCGGCTACCCAGCAGAGCTCTCCGTCGACCGACACgacctcgtccaccaccCTGACGGACACGACCAcggcatcgtcgccgtccacctcAATGGAC
ACCACGACGCAGGGAACTGATACTACGACGCAGGGAACTGATACTACGACGCAGGGAACTGATACCACGACGCAGGGCATCGACACTACCACCACGGACA
CCGGCACCTGGGGCACAGACACCGCCACAACGGGCACCACCGACTCTGCCGAGACGCCATGTGCTAGCGGAGACTCGGACACGACGGGCACCTGGGGAAC
TTCCGGCACGGACGCTACCTCGACCGACACCACGTCACTGCAGACGACCGGTACTTCTGGTTGGGGCACTAGCACCGGCACGACTTCCGCTGAGACTCCT
TGCTCCGGCGACCAGAGCTCCACAGGCACCTGGGGAACTTCGACGGGCACGACCGCGACTGACACCACCGCCCAGCAAACTACGGGCACTGCAACCACGA
CCAGAGCGTCGAGTTGGGGAACTTCGACGGGTGCGACCACGGCTGCGATTGATACCGCTACTCAGGGCGCCACGGGTAGTGTCCCGACAACGACGTCTAG
CACCGGAGCCACGTCGACGgacacgacgcagcagacCAGCGGCACCGACACGACCAGCACGGATACGACTGGCACTTGGGGGACCACGGGTACCACCGAG
CAAGCTGGTACGGTGACGGCCGCCAGTGCGGCCTCCAACACCTGGGGATCCACCGGCACGTGGGGTGCCACGACTGACACGGCGGAGACGCCGTGCTCCG
AATCGGCGGACACCACCGGCACATGGGGAACTTCGACCGATACGACTACGTCGGGCACCTCGGGCGCTATGACGGACAATGCTGAGACACCGTCCGCAGC
GTCAACGGGCACATGGATTGAGATCACCAACAGCCCGAGCACGTCAACTGGAAGCTCCACaacggccacggccaccgctGACACGACCACGGACACGACT
TCAGGCAAGACTGgcgcgtcgacggcgacggccacgagcgcTCCAACGACTGATACGACCTCTTCGGCAACGTCTTCGACCTCAGCGACCGCGTCTTCGA
GCACCACTGCACCGGAAACGACGGCCCCAGCCACGACAGCTCCGGCCACCACGGCACCAGCTACGACGGCTCCAGCAGTGGCTACCAGTGCTCCCTCTTC
GGCCTCGACGGGCAAGACCGGCGTGTCGACCACCATAACGTCGTCCGCGGGCACCTCATCGGCGGACACGTACACGGCCTCTACGACATCGGCTAGCTCG
GCTGAATCCACCACGCAGCAGTCGGCCACCCAGTCGCGCCATCGCTCGCTTCGCCACTGAGCCCACTTCTCAACAGACAAGAAGACAACGTTGCCGTCCG
CTCAAGCCGAGCAAATCTCCATTCGATGCAATGCGTAAGTACTCAGAACCCCCACAGGAAGCTCAACCGTAGCCCCATGATGCATCTCCTGGCATTCATT
TCAGTGTCGTAACGAGGATAAATGTGCGTTTTCCACTTCATCTCCTCTTCAACACTTTTCTTCAGCGGTATGTCCACTCGCGCGTGATCTCCTGTTCCAA
TAGTTGGCTTCAATACGTTGGGGATGACTGAAGGTTTACCCCACAGAGGACTTGAAGTGGACATGCCGACCCAATGCAGCCAGAACGCAGTAGGAGCAAC
GGGCTCGACCTCCTATTTTGGCCGGACTTGGTGTCAGGAAACGGCAACTGCCGTGCAAGTACTAAGAGATGTCGACGCTGCTTGATGGCACTCTCTGAAC
GACGATATTTCGCGGAGTGGCCCACTCGTTCACCCAAATCAATCTCTTTCAGGTGTTCTCTTCAATTTGTTTTCACCCACGAGTCCACCCACATAAAAAA