Description :
From Genome Similarity Track
Location :
Scaffold_7:996075- 999822
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05345hypothetical protein
Phypa_INRA-310PPTG_05346deoxyribodipyrimidine photolyase
Phypa_INRA-310PPTG_05347E3 ubiquitin-protein ligase MARCH6 (membrane-associated RING finger protein 6)

Sequence
3747 bases(100 bases per row)
TTTCTCGTGCGGCATCGGAGTAAATTGCTTGCGAGAGTGCAGTCTCAGAACCAACGAGTTGTCGCTCGTACCGCGCGCAAATAACTTCAAGTTGCTGTAC
TCGTTGACGACCGACAGCGGCCAGTGCCTGTGTCTCCAGTGTGGAACCCGAGGCAGAAGTTGACTCTGTACCTGGTGAAGAAGCACGATGCAAGTCCAGG
AGTGTCTGGTCTTCTGCGCTAATAGCGTCATGACGTCCAAGATCATCAGGTTTGTCAGCGGTGACAAGTTGGAACTCTTCTTCTCGCATGCACAGCGCTG
TAAGAGCTTCGATTAGTCCTAAGAATTGATGCTGCACGTCGACGACCTGGCGACGATATCTCTCAAGTTCGGCGAATACTCGGTCCTGTACGCATTGAGC
TCGTGCTTGTTCACTCTGAAGACGACGCACTTGTTGCTCACTTTGACCAACATGCGAGCTCAACTGCACTAAATGCTCAACGACTTGGGACTTTTTGAGT
AGCTTGAAGTAAGTATCCGAGTTCATCGGCGATACATGGGGGCTCGGAGTTGGTTTTGTTGCACTAGACTCTGTTGCCTTCAACGATTCATCGGATGCCA
TTGGAGATGTACAATCTGGGTCTGAACAATATTTGTACGCACGGGATCGAGATGCTGCATTTGGTGTAGAAGTTGGAGTAAATGTCTTTTGTTTAGTGAC
TTGAGCTGGCACTGGAGGGGGTACACTCGATGCAGAAGCTGGAGAGTTCACGCGCGTAGACGGACAAGAGAGTGAGTGGCATTTCAGGAGCTTTTTGTCT
ACAGGATAAACAGCAGCATTGATGTGCATGGTCTTAGTCTGTTGCTGCGAAAGATTCGTAGCAATCGATAAAGGTGGGCGACTTGTTCGTGCTTGCACCT
CCATTGCTGCTCAATTTCTACTTGCGAAGTGATCACCCTCACATTAACAATAAAAATGGCTTCATTTGGTAAAAATACATGCATATTTTTGCATCTGCGG
CAAACCCTCTTATCTTCACTTATGCTGTGTCTTCATCTTCTTCGTAGTTGTTCCAGCAGCGCCACTTTCCGCTGGCCTCGTCGCCCCAATCTTACGGCCA
GGTTTCGCAGATACTTCTTCCTCTTGTGGATCAGTCTCTTGGTCTCCTGAACCTTTCTTGGCCTGAGCTGCTAGTCGTCCAACCTTGAGCACATACGCGT
CCATGCGGAACTTGCGCTTGAGACCAGCTTCATTCATATAGCGCACTTTGCCGAAGATTGGCCGTTCTTTCCAGCCTTGATCGTGCTTTCCGAACGTCCA
GGCCACCCCTGCGTACGAGTTTGGATCAGGTGCATCCAAGGCGTACTTGTTATTTAGAACTAGCGCCGCATTGAAACCTTCCTCGGGAGTTCGTGTCCAC
TCCAGCAACTTCTTGCCCCAATACATGCGCATGTAGCCGTGCATCTTTCCCGTTACCACTAACTCGCGTTGTGCAGCGTTCCAAAATCTGTCTCCAGTTT
GATAATTCTCGAGCTTATCCCGTGAGTACAATTGGTCTCGCTTGTCATCAGCATGTTCCTGCAGCGTGATCTGCGCGTAGCTCGGAAGACAGCGCATGGA
GTCGTAGTTACCTTGGTTGTAGACTACCAGATTCACGGATAATTCACGGCGTACGATGAGTTCCTCGAGGAACGAAGCCAATCCTTCCTTTGCTCGCTGC
ACACCCCTCAGTTTGTTAGCAGCTAGCACTATACGGACGACGCTAATGTGTCCATAGTGCAGATAAAGACTCAAGTCGCTGCCAGCGTCCAGACTTGGCT
CGTTGCGTTCAGTGGCGTAACTCGCAAGTTTATCTGCTGTGAGGAACTTCTTCGCACAAGCTGAAGCTGCAGCCTCGCCTCCTTTAAAATACCAGTTCAC
TCCCTTAACACTACGATTGACATCCAGCAGCTCCAGTGTGCTAGCTACAGCCTCCGAACTCGTCACATCAAGCGGCTTTAGCTGCTCGAGTTCACCGAGG
ACAGTCAACAGTGACTTTCCTTCTGTATGGTACGCTGGGTCCAGGATCATAACCTCTAAACGAGCGACGTACTGATCTAAGTGCTTAGTGATCTTGGGAC
GGATCGTACGTGCCGCGTATTCTTCCTTATCTGTAACCACAGCAGCAGGAACCACAACGTCGCCTTCAATCTGGACAATTCCAAAGCAAGAGCCTTCACC
AGCGTCACCTTTATCTTCCACTGTCGAAACGAGCTTGTCCAGCGCCGAGCGCCACGGTCGCAAGTATGGACGATCCGTCACTACCAGTGCAGCTTTGCGC
GCACAAAAGTCCAGTAGTTCGTTGCGTGTTGGACGCCCATTTTCCTTGTGTTGGTGGTGGAAGACGTCAAGATTCAAGCCATGGCGTGCGAGACGCTGGT
ACGTATCGGCCAGACCTTCCAGCGCGAAGAGCGCGTGCCTTTCAGTGGCGAATGCGTGAGCATTCGCGTCTTGAATCGCTTCAGCCTTCCACTCATCGTC
CTCACTTGGCTGGAGAGCTGGAGCTACCGAGCGATCTGGGAATAGATACACCACATGCAGAGGAAGCTTCAACTCGTTGGCAGCCGCCACTGCGTATTCC
AGCGCGTAGTTGTGCTTGGTACGCACTGACGTCTGCATCCAGTAGAGCAGGTACCCGCCCTCGGGCTGAGACGCGGTGCCTTCGTACAGCCATTGAACGC
GTTCGCGGTGCAGACCGCCGGGTAGTTTGAGCTGCTCCAGAGCGCGACGAACGTTCACCATATCTTTGGAAGAGGTGGTCTTGAGAATGACTACGGCCGA
CTTCGTCTGGATGAATTGAGACTTTGATCCGACCTGTTGGCGGAACACGACCGTCGTTTTCTCTCCAACTTTTTGATATTTCTTATAAAAAAAACATAAG
AAAAAATCTGTTAAAGTGGCAGAATTTTTATCAATTGAGCCTTGTTATCCACATGAGTTCCTCTCATCCTAATCTAATGTCAATACACGCAACGAGGTTC
GCAGCAGGAGTTGGAGTAGAATTGCTGACCGCCTTGGTCGACAGCCAGGCACCCCTTACGTTCTGAAGATGTGAACGCAATTATACCACCGCCTGACTGG
GAGCAGAGGTCAGTACTTCATCTCCTGGTGCTTCAGAAGTTCCTTCTACCGTGCCATGTCTTGTAGCTGGCGGCCGATCAAGTAACGTTCATTACGGATC
GACTCGCTCAGATTCGACAGCCACCGGGTCACGTGCGAGTGCGAGCGCACTAACACAAACACTGTACCGACCCAGAACGCGCACATGGCGAAGGCAGTCT
TCTCAAAGTTGGTCTTTTCGGATGAAAAGACCAGCAAGACCACAGAAGACAGCAGCCACGGCACCACTAACATCCCCAGAAGGAACGTCGCGATTGGCTG
TAGTACATTCACTTGGAAAAACTCCACGTCGAAACACTTCTCGCGAATATTATCCCGACGAAGTCGAATACCCTCGTTATCGTGCACCGTCACGTTGAAT
TGGAGTTGACGGTACGCCTTGCGGAAAGAGGCGATGAAACCCACAGGCTCTACCACAGCAACAGCACCCTCACCATTTCGTTGTCTTTCCTCTTCTTCAA
GCTCATCGTCATCCAGATCGTCCTCGAAAAGCTCGTCTTCATTGTCCACATCCAAGAATCCATCCTCGTCCGCTTCCAGCTCTTCAAGAGCTGCTTGTCG
CTGGTTACGGCGTCGATTTCGCTTCGCTCGGAAGCAGCAAACCAACC