Description :
From Genome Similarity Track
Location :
Scaffold_185:996- 2710
Sequence
1714 bases(100 bases per row)
CATGCAAGGTCGCACAGGCTCGAACCCTGGGATGGTCCAGCAGCAGCATCCGTCGTCCCAAGCGAAGCCAGCCTCTGCCCAAGCTCCGGAGAAGAAGAGT
AACGACGCATGGGGTGCAGGCTCGTCGCTGTTTGACCTCAACAACCTGGGGTCGTCGTCATCGAGCGGCATTTCTGCAAGCAGCGGACGTCCAAACCAGC
CCGGTGGCAATGTCAACCAGAATAGCTTTAGCGGGCTGGACACGCTGGCTGGGATGCCGAGCAAGCCAGTGACGATGGGCGGCGGCATGAACCCGATGGG
CGGCGGCGGCATGGGCGGCATGAACTACGGTATGGGTATGGGTATGCCGCAGCAGCAACAGCAGCCTGGCGCGATGGGCTACGGTCAGATGCAGATGGGA
GGCATGGGAATGGGCATGCAACAGCCTCGTCCGATGATGGGCATGGGCATGCAGCAGCAGCCTGGCGCCATGGGCGGCATGATGAACCAGGGCGGCTTCG
GTGGTATGCAGCAGCCCCAGCAGCAGCAACAGCAGCAGCAGCAGCAACAGCAGCACAACCCGTTCGGCAGCTTTGGCACCTTCTAGAGCCACCCACCGCA
AGCGACGGCGGAGCCAAGCTGCTCGCTGCGTCATGTCGAAGACTTAGGACCATCGTTTCGTGTGGGAAGCGTCGAGAGAGAGAGAAGGGAATGAACCTGA
ACACTGGTGAATCCTGTCGTGGCGTGTTCGCCGACACCAAGTTTTCACGCACAGACAACTGATCTTTCTCATTCCAAACAGGCTTACAACACGGGGCTGG
CCTGACGCGCAGGCTTCCAGCCGTCTATGGAGGCGACGCCCTCCATCCAAGGCAATTATCAAACGACGACGTGGAGGGTTTACTTTGCCGGCTCGGGGCT
CGGACTCTCAGGCGGCTCCGGGTCCGGCCAGGCGTCCTCCATCTCGTGGTCAGCGCTATCACCACCACCACCACCACTACCACCACCTATAGGCGCCGCG
AAGAGCGCGCTGGTGCTGAGCGACTTGAACAGCCGCGTGCCGAGGGCGTCGACGCTGTCCCCGCCGTGCGAGAGCATGTTGATCTGGCTCGAGGTCTTCT
TGAGCATGTGGCTGCCGGGACCGACGGCCGCCGCCACGTGGGCCTCGTCCACGTGCACCGACTTGCGCTTGCGTATCCCCTCGGGACACTTGGCGAGCAC
GCTGAAGGCCGACGACGCGCGCAGGTGGCTCGGGATCGACAGCCGCACGCGGGGCGAAGGCGTCGAGTCCGCGCGGATCCTCCGGCCCGCGTCGCCCTCC
TCGCCGTCCAGCTCGAGCCGCGTGATCTCAACCTCGTCGACGCTCATGCACAGGTCGAAGCCGTGCTCGTCCTCGTCTTCCTCCGACCCGGCGGCCGTGG
AGCTCCCGAGCCGGCGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTTGCGTAACACGTCGCGAGGCT
GCGGCGACGACGGCGGCGTGGCCGGCCGCTCGCGGAAAGAGGCGTTGAACACGGGGCCGCGCGGGATCGCGGCCAGGTCGCCGTACCGCCCCGACGGCGA
CTGGCGGTCNNNNNNNNNNNNNNNNNNNNNNNGAGCTTCTCGCGCAGCAGCACCAGGTCCTCCGGGTCGCTCACGAGCGAGTTGCGCCGCAGCGCCGAGC
CGATGTTGACGGGG