Description :
From Genome Similarity Track
Location :
Scaffold_709:996- 2423
Transcript NameFunction/comments
Phymu_g11661hypothetical protein PHYSODRAFT_249642

Sequence
1427 bases(100 bases per row)
ACGTAGTACGGGTCGTCCTGGTACTCTACGTCGCAGTACGGGAACGCAGTGTCGTCTTCCGACGgcgtgaagagctgcttACCAGCGTGGATCATAACGT
AGCAGCCCACAGAGCCACACACCAGCATCACGAGCATCGAAACTACCTTGTCCAGAACTGAcatcttcttccagaagACCCGCAGGTAGATCAACACCGG
CATGATCATACAGTTGACTGTGTGGGCAGTCGAACCCGTGAAGTCCTCAAGATCCAAGAATTTGTTCTGTGCAGCCACCGACACGATGACCATAAGGACA
ATGATCGTGATACGCAGTGTAATGTACCGGATCGTGTTCTTGGCCCCCTTGTACGGCTCACGAAGCTGCGCCTCAGTGATTTCTTCAAAGAACTCATGCC
CCGACAGCGCCCGAGGGGTAGTGGCTTGTACATACGACTGCTTCTCCAGATCTCCGTCCAAGTTCTGGGCTTCTGGAgcgttgaagcgcacaaTTGGAGC
TGTTTTGTGCATTCCTAACACCAACCGCTCGGCCATATAGAACGCCGGCATCATCATGgtcgagaaggcgatggaaATGTGCACCTGCATGAATAAATAC
GCCATCACGACAGCGCCACGGTTGGGCGTGAAGCCCAGAGGAGCTTCACCCAACGGGTTGGACGTGTCCACGATGGAATACAAAATGTTGCCGGAGATCT
GACAGCCGCCCGCAGTGTAACCGGCCAGAgcgatggcgaagaagaaggccgagaTGATCAACATCGTGATCATCACAACGCGCGGCATCCGTTGAGGCTG
CGAGTGTTCGCGTTGGAGATCAGGAATGACGATCGAAGCGCCGTAAGCTAGCGCCAAGTTACCGAAACACGTCAGGATCTGGTGCAACGACGCGTCCGGC
TTGGGGATCGACGGGTGGCCGCGCATGTTGTACTGAAGGATGGACACGGCGATGACGTCGGCGATGGCAGTGCCCAAACACCCAGCGAACGCCATTCCAG
CACTCTCCTTGAGCGTCGGGATGAGGCACACGGGGATAACCATCAGAGCCATGAAGATGATCCAAAAGGTTTGACTGAACGAGTCGgggaacagcacgtc
gagTAGTGTACTAcccaagatcaagaaggcgcaggGAACCAGCACACAGACGCCCATTTGAGACACCACAGTGAAGAACCGACCCCATTTTCCAAGAGCC
CATTCACCGAGGTCACCGTACGTCCGGACggacgaaggagcagccAGCATGGCCTTGGACAGCTTCACTGCAGCGTAcgtgttggcgaagatcATGACAG
CAAGCGCGATCGTGGCGTAGAGCGGTCCCGCGCGCGCGTAGTTGGACGGCATAGCGAGGGAACCGATGCCgaggacgcagcagaagaggTTGAACGACGC
CTTCGCATCGTCCATCGTGACGAAAGC