Description :
From Genome Similarity Track
Location :
Scaffold_110:99599- 102383
Transcript NameFunction/comments
g18622.t1hypothetical protein

Sequence
2784 bases(100 bases per row)
GTGTATTTCAACTACGCGCCGGGCAACGCGACGTTCGACAAGTGCTCGAACGTGGTGGTGACGTCCAAGTACTCGCTCGTGACCTTCCTGCCCAAGTTTC
TGAAGGAGAGCTTCAGTAAAGTGGCCAACTTCTTCTTCCTCATGGTGTGCGTGCTGCAGAGCATCCCGAGCATCAGCAACACGTACGGCTACCCGACGAA
CGCGCCCGTGCTCTTCTTTGTGATCTCTATCGACGCCGTGTTCGCCGTCATGGAGGACATGCGCCGCCACAAGTCGGACAACGAGGCCAACTCGGCCACG
TGCCACGTGGTTCAGGACGGACACGTCGTGGACAGGAAGTGGTCGGACATTAAGGTGGGAGACTTTTTGCAGATCAAAAACCGAGAGGTCATCCCCGCCG
ACGTGCTCGTGTTGGCTGTGGCGGAGCCTGTGGGCGAACCGCCCAGCGGCATTTGCTACGTCGAGACCAAGAGTCTGGACGGAGAGACGAACCTCAAGCT
GCGCCAGGCGGTGGCGGCGACCATGAGCTCGCTGGCGAACGCGGCCGAGCTGTCCTCGCTGCGCGGCGTCGTCAAGTGCGAGCAGCCCAACCCGCACATT
AACAAGTTTGCAGGCAAAGTGGAGGTTACAGTGGGGGACGGCTGCGGCGTTGAGGTGATGCCGCTGTCAGTTAAGAACGTGCTGCTACGCGGTTGCAACC
TGCGCAACACGGACTGGGTGTTTGCACTGGTGCTCAACACAGGCATCGACACGAAGATCATGCAGAGTTCCAGCGCCGCCCCGTCCAAGTGGAGCGACCT
CATGCTCAACATCAACCGGATGATTGTCATTCTGTGCATCGGGCTCTTCGTGGCCTGTGCCGTGGCTGCTACGTGCTACATCACGTGGCAGTACGACATC
GTGCGGAACACGTGGTACATCCAGCTGTCCGAAACGGAGAGGAACCGCACGCGCTTCGTAGCGTTCATCCAGATGATGTTCTACTACTTCTTGCTGCTGT
ACCAGGTCATTCCGATCTCGTTGTACGTGTCCATGACGAGTGTCAAGTTCCTGCAGTCTCGTTTCATGTCGTGGGATCTGGAGATGTACCACGCCGAGAC
GGACACCCCCGCTATCGTACGGACGATGGAGCTGAACGAAGAGCTGGGTCAGATCTCGTACGTCTTCAGTGACAAGACGGGAACGCTGACGTGCAACATC
ATGGAGTTCCGCAAGTGCTCCATCAATGGAATTTCGTACGGCTCCGGTATCACGGAAATCGGACGCGCTGCGCTGGTTCGCGCGGGAAAGCCCATTCCAC
CGGAGCCCAAGCTGGACCCGAGCATCAAGACGATCCCGTTTGTAAACTTCGTCGACAAGGCACTCTTTGACGGAATGAAAGGCAGCGCAGGCGAGGAGCA
AAAGGAGAAGATCCTGCAATTCTTCGAGCACCTCGCTGTGTGCCATACAGTGATCCCCGAGAAACTCGAGTCTGGTGAAGTCCGGCTATCAGCGTCGTCT
CCTGACGAGCAAGCCCTGGTGGCTGGTGCTGCCTTCGCAGGGTTTAAGTTTGAAAGCCGTAGCGTGGGGACAGCGAACGTGGAGGTCATGGGCCAGCGCG
TGACCTACGAAGTGCTGGACGTGCTCGAATTTAACAGTACGAGAAAGCGTATGTCTGTGGTGGTGCGCAAGCCGGACGGAGAGCTGCTGCTTTACACGAA
GGGAGCCGACATGATGATTTATCAGCGCCTGAAGGATAACCCAGCGATGCAGAAGATCAAGAACATCACACGCGACCACATGGAGAAGTACGCTGACGAT
GGCTTGCGTACTCTTGCTCTCGCGATGAAGAAACTTGACGAACGCTGGTTCCAACAGTGGAAGATGCGCTTCGATGATGCGCAAGGCAACGTGGCGGAGC
TCGACCGACGCAAAGATGGCAAACCCAATGCAATCGACGACCTCATGGAAGAAATGGAGGGGGGCTTGGAGCTGATTGGCGCAACGGCGATCGAAGACAA
GCTGCAAGATGGTGTGCCGCAGTGTCTCGCAAACCTGACGCGTGCTGGAATCAAGGTCTGGATGCTTACGGGCGACAAGGAGGAGACTGCGATTAACATC
TCGTATGCTTGCTCGCTGCTAGACAACTCGATCCAGCAAGTCATCGTTAACGCGACCACATGCCCGGATGAGGCGACGATCCGAGCCAAATTGAATGCTG
CGGCCCGGGAGTTCATGGAAAACGCGAAGGGTATGGCAGGTGGGGCCGAGAAGGAAATCTCGCTGATCATCGACGGCGAGGCTCTTGAAATGGCCCTCAA
GCCTGGAACTGCGCCGCACCTCCTGTCGTTTGCCAAACTGTGTCGCGCGGTGATTTGCAACCGTGTATCTCCGGCCCAGAAGGCGGAGATGGTGAAGCTG
GTCCGAGATAACATCACCACGGTCCGTACGCTTGCTATCGGCGATGGTGCTAACGACGTTGCCATGATCCAAGCCGCGCATGTCGGCGTGGGTATCTCTG
GACAGGAAGGAATGCAAGCTGTGAACTCGAGTGACTACGCCATTGCGCAGTTCCGCTTCCTTGAGCGGCTGCTTTTGGTTCACGGACGGTGGAACTACAT
TCGTATCTCCAAGCTGGTGCTGTACATGTTCTACAAGAACATCACGCTCGTGCTGGCGCAGTACTGGTACGGTTACCTCTCGGGTGCTTCTGGCTCCAAG
ATGTACTGGGAAATCGGTGTCCAGCTTTACAACGTGGCTTTCACGGGTCTTCCGATCGTGGTCGTGGGCGTGATGGACAAGGAC