Description :
From Genome Similarity Track
Location :
contig_64:99597- 101865
Transcript NameFunction/comments
g11544.t1hypothetical protein

Sequence
2268 bases(100 bases per row)
ACCCTGCGCAACATGTGGGTCTTGTCCAGCACTTTCAACGTCATGTACTCATTTCTGGCGCTGGCAGTTGTGCCGCTTGACACGATCATCTCGAACCAGT
CGACGCTGCTGTCGTACATGGGAAGGTTGAGTGGCGGTCGGTGGCTGGAGATTCTCGTAGCAATCGACGCGTTTGGCGTGTTGGCTGGCGCGGTTTTGAC
GGCGTACGTTGGCATTAATGGGCTCTTCCAGCGCCTGGCAATCGATAGAGTGCTACCCAGCTTCCTACTCAAGGTGAATTCGTGCCGCGGCACGAACCAC
TTTATCATCTTGGTGTTCTGCGTCGTGGCTTCGAGTCTCGTATTCATCTTGGATGCCGAAGTGACGGTGTTGTCTGGTGTCTTCGCGCTCGCGTTCCTCT
GCGTGCTGCTGTCGTTCACGATTGCTTGTCTGCTACTGAAGATCGGCCGTGAAGAAATCCCGCGCAAAAGAACAACGTCGTGGTTCAACACTTGCTTCTG
CCTGGGTATGATCACGTTGGGAATTCTTGCGAATGCGTTCTCCGATATCAAGGCGCTGTCGTATTTCTTCATCTACTTCGCCGTCTTCTTCCTGGTCGTG
TTCCTGATGCTGACCCGCGTGAGTCTGCTCAAGGGATTACTCTACATTTCGCGCAAGCTGTTGCTGCACTTCCGAGGTCACAGTGAGTCAGTATCCATGC
AGCAGCTCTCGGTTCAGGGCCAGGCTTTTGTCGGCAGTGTGAAGATTGCCAAGACGATCGAGACGATCAAGAACACGCCTGTGGTCTTCTTCTGCAAGGT
GGCCAACTTGCCCAAGATCAACGAGGCGGTGCGGTACGTGATGCAGAACGAGCACACGTACTGCCTGCGACTCGTTCACGTGTGCGAGCCGAAGGCGCCT
GTGCCGCGTGAGTTTGAGCACGTGGTGAACTTGTTTGACCACATTTACCCGTCGATCAAGATCGATTTCATCGCCGTGACGGGAGCGTTTGACCCGGCGA
TGGTGCAGTGGCTGTCGAAATCGATGGCTGTTCCTACGAACATGATGTTCATGCGTCAACCCGCTAACGAGAACATCCACCGCGTGTCGGCGCTTGGCGT
GCGTGTCATTACGGATTAGACGTTCACGAGTCTACTTCGGCTAGCGAGTGGACTTGCTAAGTTAAAGAGAGAGCTCGAGTTTGCTGTTTCGTGTCAAGGA
TGATCGCACCGCTTTCCGGTATCCGGATACTGTACCTACATGTTCACGTACATGTACACGGATGGTTTGGAAATTGACTTTCGGTTCGCAGTGGTAGACT
GCCGCAATGATTGCCAGTTTGCGACAGGTACTGGTACAAAAGCTCACGTGTGATAGGCAGGCACTCTGCAATCATGGGATGTGACTCCGATTAGCATGTC
CGACTGCCAGTCGGCGACTGGGGAGTTGGTCATTGTCCATTTCTCCAGTTCAGACTGAGAGCGCAGTCGCCGCCGCGTCACTCTGCAGCGGCATGTCGTC
GCCTCTTTTCATCTTGGCAGTGTTCCTCGCAATAACTGCAGCAGCTGAGCACCGCAACACGCTGCACAACTTGCAGAATGAGACGATGACAGAATGGCCA
TCATTGCGCTTCCATTTCACCATCAAGCGCGACGCCATGCAAGTTCACGGCCACTCCGAGTTCTCTGTGCTGGCTAACCCTGTTGTGTCCACCAATGGCG
ATAACAGTGACAGCGTGCTGTACGACACCTTTGCTACGTTCGAGGAGGACTCGATGATGCACACCTACACACTCGTAGACGGTATCGCGTACGTCTCCGA
GAGCTCTGTGGACGATATCAGCGTTGACCCTTTGGTGAAATGCGTGGAGTCAGGAGTTCTGATTCCAATCAACTCGATCGTGTTGGCACTCAACGAGGCT
GTTCCTGTCTCGAGTATCTCATCGAAAAGTAGCGGAACCATCGAGTGTTCCAGTGGGAACACGTTCAAAGCCACAGTAAACGGTTTTGATCTCGGATTGT
GTTTCTCGGATTCTTCCGGATTCACGATGTATGGCAACGATATGAATATCGCCGTGGAGTATTTGGAGAGTCGTGAAGACATTGCCGCGCCAACGATCAA
GAGTGACGTGAAGAATGAGTGCGAAAAAGTGGCGTCGGCTAGCTCAGTGACATCGATCGGGAGGTCATTTCTGACTGGGGCATCGATTTCTCTCGAGGAT
ACGAGAGAACTGCGAGCTGCGTTCGATTTCGATTTCTCGATTGGTGATGATGATACGTGCTCGTGCAA