Description :
From Genome Similarity Track
Location :
Scaffold_28:9959- 11376
Transcript NameFunction/comments
Albla_Nc14030840Amino Acid/Auxin Permease (AAAP) Family putative

Sequence
1417 bases(100 bases per row)
AGTTGTAGTACAGGTCGTTTTTGTACCGGGGAGCACAGAATGGGAACTTGATGGAATGATCAGGCCGAGTGAATAACTCACGACCTGTTTGATACGTCAC
ATACGCGCCAAATGAAAAGCAGATGACGGCGATGGTGACGGCCACAATTTTTTCGTACAAGGGAACTTGATCACCCAGCTTGTAAAGATAAAATACAATG
GGTAAGACGATACAGCTCATGGTGATACAGGAGGCACCGATGAAATCTGCAAATTCGCCAAAATGTTCTCGAAAAAATACGGAGATCATGACCAGTATCG
CGACTACCACAACGCGGAGGATGATGTACTTGATAGTGTTTGGCCCTTGATATTCTAATGCTTCGTCTTCAAATAATTCAGGTTGCTCAATATCTGCGAT
GGAGATGAAAGACCGCTTTTTAGAGATCCGAGTTCCCTCACTCGGTGTGGTGTTATTGCCGTAATGAGAAGCTTTTTCGATGTCGTCCAATGCACAAGGT
ACATTGCGATGCATTCCTAGCAGGGAACGTTCCAAAGTGAAGAAGGCGGGATGGATGAGAACTGAGAATGCAATGGTGATGTGAAATTGCACGCCCAAAA
ATGCCATGACAGCCGCTCCTCGAGGCGTTCGGACTCCAAGAGCACTGAGACCAGTTTTGTGGTCCGGGAAAATGGAGAAGAGAAGGTTGCCCGAAATTTG
GCATCCCACTGCTGAGTACCCTGATCCAGCAAGCGTTAGAAATAGGCACGTGATACACACGAGGGTGACGGTGATGATACGCGGCATCCGAGTAGGGTCA
CTATGCTGACGCTGAAGTGCTGGAATCACAACACCGGCACCATACGCTAGCGATAAGTTCCCAAAAGTTCCAGCAATTTGATCAAAGCTCAAATCAGGTC
TGGGAATCTCTGGATGTCCGCTCATTCCATGCAGCAATACCCCCACACTGATAAAATCCGCCAATATGGTTCCACTGCATCCAGCAAGCGCGGCAAAAGC
TCCTTCCTTCATTGTTGGAGTCAAACAAACGGGCAAGACTGCAAATGCCATCAACAAAATCCATGTAGATTGCTCAAATGTCCCCGGAAACAGATTCTTC
AGTAGTGTACCGCCCAAGACAAGGTATGCACACGGCATAAGCAGACAATCCGTGATTTGGAACAGGACCACCAGATAACGACCCGTGCGATTCATACACC
AGTCTCCGAGGTCTCCAAATGTTCTCACTGATCGAGGCGCACAGAGCATGATTTTCGACAAGACAATGGATGAGTAGATGTTTGCAGCTGCCATGAACGC
AAGGGCACAAGTGGCGATGACTGGACCCACACGTGAGAAATTCCCAGGCATTCCCAAAGTACCGATCCCATAGACACAGCAAAAAATGCTGAAGGCGATT
TTGCTATCTTCCAACGT