Description :
From Genome Similarity Track
Location :
Scaffold_372:9958- 17291
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_372-fgenesh-gene-0.1Tetratricopeptide repeat protein
Pytir_DAOMBR486maker-pir_contig_372-snap-gene-0.11Histone-lysine N-methyltransferase
Pytir_DAOMBR486maker-pir_contig_372-fgenesh-gene-0.7Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_372-snap-gene-0.12Gene of unknown function

Sequence
7333 bases(100 bases per row)
GACGACTTCCTGGAAGAGCTGATCGGCGTGAGCGCCGCCGCCATCGCAGACGTGAAGGAAGACCACTATGTGGTCGTGCAGGAGAGCTTCCTCGCCGTCG
AGCGCGCCGTGCTTGAGACCGACAGCGCGCAAGCCGCCGGTGTGCTCAAGAAGCTGCTGGCTGCGGGCGAGCCGACCACGAGCACCGTCGTGAGCGCGAT
CGAGATGGCCAAGCTGATCTGCGACGGCAAGTACGCCGACGTGGTGCGCACAACGCGCGGACTCCAGTTGCTGAGCGCGCTCGCGCAGTCCGCGAGCGTG
TCTACACAGGGCGACAACGCGGACGTGCACTTCTGCACGACGGTGACCCAGGCGCTGGAGCAGGTCCTGCTGCAAGAAGCCGAGCAAGATCGCCTTGGCG
CTGCGTATGAGGTGTTCTTCGTGGGCACTGCGTTTTTCAACATGTACGTGCAGGCGAACTACACTGGTCCAGCGTTCGACAAGGAGCACTTGCGCGACAT
CAACGCGCTGATCGGTCGTCTGTTTTACGGCGACAATGAGTTCGAGGAGAAGAAGATGCACAGTGACTCGCTGGTGGCGCTGCAAGTGGACGGCGAGAGC
CCGTTCTCAATCTGTGAGTTTCCGCAGTTCTTGCTGGTCGGTCGATGTCTGCTACACTTCGTCGGCAACGCGACCCACAAGAACTGGTCGTTCGCGATCG
GCGAAACTGGAACCGAGAGCGCTGCGCAGGACGTGATCTCGACTCCCAGCGTCGGACCAGAGCTCCTCGCCCTGCTGACGACAATCCACTCTGCGACGTG
GTGGAACGCCCGCGCGGCGGTGACACACGAGCGCCTGCTGCTCACGAAGGCGTGCTCGAACACGCTCTGGTTCGAAGCGCGCCGCGGCTTTTTCAAGACC
ATGCGCAGCTCGTCGTCGCTCTTCAACTTCAAGACCTCCGAGTACCTGCGCGCGCGGCTGGACGTCGAGTGGGGACTCGCGCAAAGCCACTTTGACAAGA
ACAAGCAGGGCAAGCGCAGCTTCGAGCAGGCGAAGGAAGTGAGCGGCATCAGCGTCCAGCTGAGCGGTTCTATGGGCAAGCGCACCAAGTTCCAACAGAA
GAGCACCGCGCAGATGGTGCTGCTCGCAGCGTCCAAGTACCCACCGAGTGACGGGGCACCGTCAGTGTATGCCACTGCTGCGGCTGCGAGTACGCATGCG
GACTTTGGCGGCAAGATGATGCAAGTGGGCGGCGACGAAGAAGGACTGACGGAAGAGGAGAAAGAGCTTCAGCGCATGGTGCGCGAGGGCGAGGCGACGT
ACCGCGACATCAACCTGGACCAGGTGGACCAGGACAACATCCTGTATGAGCACATCGCGTTCGAGGACAAGTCGCTGACCGAACAGGGTAACCTGCAGGT
GATCGACCAGGTGATCCTGCTCGCGCTCTGCCTCGACGTGAAGAACAGCAACGCGAACGACGGGCTCACGCGCGAAGAGATGTTCCCGTACATCACGCGC
GTGCTCGAGAACCCGAACAACTGGATGGTGTACTCCACGGGCCTGCTCGAGCGCGCGTGGCTCGAGTGCGAGACCTCGAAGCGCCGCGAGCGCGCGATCC
TGCAGATGCAGGCGCTCGTGGACCAGCATACAACGCGCCTCACGATCACGCAGAACACGCTCAAGTCGATTGAAGACGCGGCGCCGGCGAACGAGCGCAT
GCAGTACGTGCACGCGCTCGCGTTCCCGCCGCGGTACGCGTTGAAGCGTGACCTCGCGGAACGATATCTGGCGATTGGCGTGATCCAGTCGGCGCTCGAG
ATCTTCGAGGAGCTCGAGATGTGGGACGACGTGGTCAAGTGCTACCAGATCCTAGACAAGCCACTGCGCGCTGAAAAGCTTATCCGCGAGCGCCTAGAGG
TGGCGCCGACGCCGTATATGTGGTGCTGTCTGGGTGACGTCACGCAGGAGATCTCCCACTATGTGACGTCGTGGGAGCTCTCGAAGCACCGCTTCGCGCG
CGCCAAGCGGTCACTGGGCCGCCACTACTTTGAGAAGGGTGAGTACGAGACCGCGATCGAGCACTACGCCAAGAGTGTGGACGTGAACCCGATGAACACG
AGCGCGTGGTTCGTCATGGGCTCCATGAGCATGCGACTCGAGAAGTGGGACCTCGCGCTGCGCTCGTTCACGCGTGTGGCGCAGCTCGAGCCGGACCACG
GCGAAGCCTGGGGCAATATCGGCTCAATCCACATGCGCAACCACCGGTACTCGGAGGCGTTCTCGGTGCTGCAGGAAGCGCTCAAGCAGAAGCGCCACAT
GTGGCAGATGTGGGAGAATTACGCGGTGTGCGCCATGGAGACCGACAAGTACGGCGAGGCGATCTACGCGATGCACCAACTGCTGGACCTGCGCGCGAAG
CACAAGCGTCCGATCGACCACGAAGTGCTCGCGTGGCTTGTTGAAGCGATTGTGTACCCGGAGAGCTACAAGAAGCTCGTGGACGACCTGCAGGTCGCGA
ACGAAGAGGAGAACGACATGGAGCTCGATGATGGAGACGCAGCAGCACAAGAAGACGACGACATCGCGGACCTGGACGAAGCGGTTGTGGCCACGGACAA
GACGCCGCCGCGCTCGAACTTCAACTTCAAGAAGCAGCTCGCGCTGCTCTTCGGCCGCATCACGTCGATCACGACGAACAACGCCAAGATTTGGCAGATC
TACGCGCACTTCAATGACGGGCTCGCGCGCAAGGAGAAGGCGCTTGACTGCCGCCTTAAGCAGTGCCGCGCGCTGCAGAGCGCCGGCTGGGAGCAGGACC
AGAGCCGCGTGCAGGAGCTCTGCAAGGCAGCCGTGCGCCTCTCGGAGGACTACGTCAACGAAGGCTCAAAGAAATCGCTCTACGTGTGCCGCCTATACAT
CCGCGGCGTGCTCAAGAAGGCGCAGGTGGACTACGCGGCGCTCGAGGAAGTGCAGGCGCTCGCGGCGACGCTCGAGCGCGTGAATGAGCTCGAGAAGCAG
CTGTAGTTGTAGTAGAGAACGGTATTAAAGGCCTGCGTATAGACAGCAAGGAGTCAATAGAAACAAGCCGTGCATTTTGTACCTATGTAGCTAGCTGCTC
ATGCATGCATGCATGGTCTAATTAATTGATGAGGACGCTCTTGCGTGTCTATTCACCCCCACATTTGGCACATAGCCCACCCCATCACTTTCCCATACAA
AAAAGTGTCCACTTGAAATTCGCGCCAAGTGTGTCGATACCATTCTGTTTCTACCAATCACATCTTTCGAATACAATTTTTAGCCAATAAAATATCTCTA
TACTTTGGCGCCGATTTCAAAAACTTGCACTCAAGCAAAACTTCTGTTTGACTGCCAAACTACCTTGTGTTCACAAACCACAAGAGTGCAGACAGTCCGC
AAGTTCCCGATCAGCGAGAGGCGCACGCACATCAGACGCACGCGCGCTCACTTCTGTAGCCGGTCAGTCCTATGGTCCAGCGTCGGAGCACCGCTCGGCG
GCTCGCGGCCTCGCCCTCGTCCCCCGCCAAGCCCCCTGCAGCATTGGCTGCTGCTGCTGCCGTGAGCGTCGCGCGTGTGGAGAAGGCGCTCACGCGGTGC
GGGAAGCGCACGGCAGACGCGCTGCTGTCCGCGCTCACGCAACTGGAGCAAGAGCAGAAGGAGCCTAAGCAGGAGTCGGAGAACCAGGGAGATGACGGCG
ACGACACAGAGAAAGAGAAGGAGGAGCGAGAGACTGACGATGGCCGTGGAAATGAACAGGAGGGCGTCGAGCGAGTAGATGGTCGTGATGACGAACAGCA
GCAGCAACAGCAGCAGCAGGAGGAGGAAGAGATTGTCGTGGAGCTGACGGAGGACACGAAGTTGTTTCTGGGTGCGCTCGAGCGCGACGGACAGCGGAAG
CTGGTGATCTCGCGACCATTCGAACTGCCGTTCTCCAAGTACGAGATCAAGAACATTGAGGTGAGAGTGTAGTGAGCAAAGGGATTTACTTGGACGACTC
GTTCTTGGCAGCAGTGCTGACGCGATTGTGATTCGATTTGGGTGTGTATGGTTCCGCGATGATGATAGGCGCGCAATTTAGAGCACCGCCCGCCTCCGTA
CGGCAAGATTGCCAAGTGCGTGTTTGTGTCCAAGTCCGCGCCGTCTGCGGACCTGCCCGTGCACAAGTGCAACTGCTTCTCCGAGACGAAAGTGGTGACG
ACGAAGCGCGAGACGCAAATCGCGAGCACGAAAGCGCTATTGGCGAACGGCGGCAAGCGTCGTCTGCGCACGCACACGAAAACCAGCGGCGAGAAGAAAG
TGGAGAAGAAAGTCGTGCTCTGCGGCGAGAACTGCCACAACCGCATGCTCTTCATCAGTTGCTCGGAGGATACGTGCTCGGCGCCAGACCCGAGCATGTG
CAGCAACCGCGCAATCACGCGCAAAGAAGTCAAGTGCGTATGCTGGGTAGCTTTGACGTACCCCACTGTCTCTCGTATTGTATTTGCTCATAAATAGGTA
TTTATGGTGTCGTTACTCTCAGGTCCGTGCGCGTCGAGTACATTCCTGGTCCAGGTTTTGGGCTCATGGCAAATGAACTGATTACCTCGGGCGACTTTGT
GATCGAGTACGTGGGTGAGGTGATCGACGACCAAGAGTGCGAGCGACGCATGATCCAGTACCGAGACAGAGGAGAGGTATGTATGCGCTGACTGTGAAAT
TCGTAATGAGATGAGATGCCATGGTCGTCAACAGAAAACTCACGCTATCTTTTCATTTCTCTATCTGTAGACCCACTTCTACATGCTCGAGCTCGACAAA
GACACGCTGATCGATGCGAGATACCGAAGCAACGAGTCACGCTTCATCAACCACAGCTGCGACCCGAACTGCATGACCCAGAAATGGTTCGTTGTACATG
GTTTCGAATGTGTTTGCTGATTGAGTCCGCTGACATCGCTCATTTGTATTTTGCTGTTAATGGTATTAAATGCTAGGAATGTCGACGGCGTGCTCCGCAT
CGGCATCTTTGCGCGTCGCAACATCCAGCCAGACGAGGAAATTACAATAGACTACAACTTCTCGCACTTTGGTGAAGCCGTGGACTGCAAGTGCGGGTCC
TCGGCGTGCACGGGCAAGATTGGCCGCAAGCGCTCGGAGATCAAGATCGTGAAGGGTGTGCCTGGGAAAGCGCTCTCTGCGAAGGCAAAGCAACAACAGT
TGGAGGCACAGGAAATCGTGCCTTCAGAGATCGAGCGTCCGGTTCATGTGACATCACTCGCGCTGTTGAAAACGGCCCAGGTAAGAAGACGTGTGGAGGG
TGGGGGACTGGGCATCGCAACTGACCACACCTGTGTCGTGCCCTTGGCTTGGTTTGAATAGCTCGACACAGAATGGCTCAACCTGTATGGGTTCAACAAG
AGACGGCTCTTCTTCAGCCATGCAAAGTCGGTCAAGAAAGCCAAGACAGAAGCCAGAAGTACAGCCACTTCTTCTTCTTCCAGACAATCTTCCGCGACGT
CGTCTTCATCCAGCAGTCCAGTGTCCGAGTGGTCCTCTGCCACGGAAGACGACACGGACACATTACACGTAGCCGAGCAAAAGTCCAGGAAATTACAGAA
AAGCGGCTGGTACGCGCGCGTGAAAGAAGGCGACCACTTGCCCGAGATGCGCAAGTTACACAGCTACATCTGCGGAGGCAAGGCGGACTGGTCCAAGGAC
TTCGCAGATATGGCGCGCGACAACAAGCAGCAAGCGAGCAAACAAAAAACATGCGAACAAAAAGCAGTCAAACATCAAGTCATCAGCCGAGCGAAGAAAC
AGGCTGCGTCAGAGACCCAATTGGCGAAGATGAAGGCGAAACGCATGAGTTTGTTGGAGGCTCGAACTCGTCTGTTTACTGGTAAGGAGATTCTCGATCG
TGCTGACTGGTTGTGTTATCCGCGCCATTAGTAGCAATGGCTAACGCCGCATTTCTTATTGTCCCCACTGACGCACACAGATCTGATCTCGTTCGCGAAT
GGCACGTCCAAGTGGAACGCACGGATTCCGTCGTCCCACTCCATAGACCCAGAGCGAATCTTCCGTTTCATCGAACAGACAAAGAACGGCAAGCGCTTCC
ACATCAAAGACCTGGTACACTTCTCAAAATTTGCTCACGCATTTGGAAAATTGAATTATCATGCTGACACTCGGTATCAAAACGCCAATTCCAGAATGAT
CTCAACGAAGATGCTTGCCATCGCTGCGGTCTCAGTGGCGAACTCATTTGCTGCGATGGATGCCCAGCTGCTTTCCACCTGTGGTACGTGGTTCAGCATG
CTATTTCCGCCATCCTCAAGTCCACGTATTCTAACTGTAGCTCATGCTTCTCTGTGTTGTAGCTGTACAAACCTGGTGATGATTCCGCCAGCAAATGTCA
ACTGGTTCTGCTCTGAGTGCATGAACCCGCGCCAACACGCTCCCAGGCAGACGGACGATGCCAACAACAACGACAACAGCAACAACTCCGGCGCCAGCGA
AGAACGTATCGCTCGCCGCCAGCTGCGCACCCACGCGGCGCCGCTCGTGCCGAGCCTCAAGCGCATCTTCCACTCGAATGCGCAGCAGAAAGAGCTCGTG
AAGAAGAAGTACAAGAAGCGCGTCAAGCCCGCGGACCGCTCCTACCGCATGCTCGAGAACATGCCGCTACCGGCGATCGCAGACAGCGACGGGGAATAAC
AGCCAGAGCAAAGCGGACTCATGTCCATCATAATCTTGTCTGCCTGTTTTGATGAAGAAGACGAAAATCTCGGCTGTTCCTTCTAACAAGAGCAAATAAA
ATGTCCATGAATTAACATAGCTACGCATTTGTTGTGTATTGCGAATATTAGATATGCCTCTGTGTGGGTGCGGTTGCTAGTTATTGCTCGTACACCTTAG
CTGGCACCGGTCCTTCCACTTTGTCCTTCAGGAACTGCTCGCTGTCTTCCTTCGCTCGCTGCACAGCATAACGACATACACAGACGCCCACATGGTGACA
GCCAATGCATTTATTAGCAACACAACAAAGCCACAGTCAGCCAGCAATGATCGGAAACGGCAGGCAGTCGCTTCCATTGTCATTCATCATCTGTCGCGTG
TTACCTTGAGGGCAGTGACGAGCGCGGCGTACGGACCCGAGGACTTGAGCTCCGGCATTGGCACGCCGCCGTCCATCTTGCCCGAGTACGAGTGGTTCTG
GCGCTCCTCTTCGATCGGCGCCACGTACTCGTTCGACGCCTCCGAGGCGTTCGGGAAGCTCTCGAACGCGTGCACCTGCTCGCCGCGGAAGCGGTACGTC
GCCTTCATGCCACTCATAGTTGTTGCCTTCAAT