Description :
From Genome Similarity Track
Location :
scaffold_334:9956- 12226
Transcript NameFunction/comments
Pl_105967myosin-like protein

Sequence
2270 bases(100 bases per row)
CAAGAATTTTTCGTGTGCCATTTTATTCGGGAACGCAGCACGCGTAATGCGAATGGCTTCGACGACACCAGCGCATCGAAGCTGATTCACAACAGCATCA
ATTTCGTAGATGTTCGGGCTCTTTTGCGAATTAGGCTTAATGCACCGTACGTAGTGCACCTCCGTGCTGGAGATGTCACTCATCAGTAGCGATAGCTGGG
CCTTAAACTTGTAGCTCACAGTTTCTTGCATGAAAGTAGACGTCTTACGACTAACCGTACTGCGGCGCCCTGATTCCATCATGGTTGCAGCACGATCAGC
AAGGTCCGAGTCCGTCATGAATGCGTTGTCGTCGTCGCTAAATACCATCGACATCAAACCATTTGAGCTCGTACCCAGCAGCTCAAGCAGATCAGTCTGG
AGAGAGTCTTTGTTTTTCTCAACAAATCCTTCTGCGTCGTACGTCACAGGACCCGCATAGTGGCGGAGTAGAAACTGTGTTTGACTCAGGCGTGCTCGCT
CGAGACGAGGGTGTGACTCGCGGAGAGATACCAACTTTGACACGAACGACAGGTCGCTGCCCATGGGACGCACACACTCTTCGTTGAGCAGCGCCATCAC
GCCCATCGAGTTCTCCAGCAAGTCCAGCATATCTTGGTTGTCGCGGTACTGAACAAACTCCCAAGCTACACCCTCTTGCTGGTATTCTTCCTGCACGGTC
TTGAAGACATCCATTGTAAACTTTTGCTGCAACTTTTCGTTTGCAAAGTTAATGCAGAACTGCTCAAAGCTGTTGTGTTTGAAAGATTCGAAGCCGAAGA
TATCGAGCAAGTCAATGTGCAGGTACGACGGCGTTGAAGCACCCCTGTCCGCCGAATTCGAGATACTGTGGTTAACGCGGCGCACCAAATACCCAAACAC
TCGCGCGTAGATTTCCTTTGCCAGAGCATCACGGTTGTTGCTCGCCTGGTGATCTGACAACGGAACACAATACACTTCTTGTCGGGCCTTGACTGTGCGA
CTACAAAGCTGCTTGCTCAGCGCGGCCACTTCCACACCAAGGAGCTTTGCACACTGATCAATTTCCTTCTGCTGTTGTTCAATCTGCTCTGTTGTGACGG
CTCCAGATGGCGAAGACGCACTTAGAGAAGCAACAGCCTGGCTGGCATCGTCCTTATTAGACTCCAGCGGCACGAAATCCAGCTGACCAAGACGCAAGAT
ACCGCAGAGAGCGCTAAAGAGTTCATTCTGCTCCTTGTCGCTGAGTCCAATAGTAGTCAGCGCATCGCGAGTCACCTGATAGCGCTCAAGGTCGGTCTTT
CCGTCTAGTATGAGCTTTTCGTCCTGCAAGTACCGGAACTCCTTCGCCGAAGTGTCCTCGTTGAAACCAAACACATCTTCCTTGGCACTCACAAGCTGGT
AGAAGATGTGGTAGTTTCGTTCACCAGCAGCCTGTGCCACCACACGCGACTTCTCTAGTAGATAATGGCGGCACTCTGCTCCCACGAGACAGTACTCACT
ATTGAACTGCAGTTGAGTGAACTTTCCAAATCGACTGGAATTGTCGTTGCGGATGGTTTTGGCATTGCCAAAGGACTCCAATAAAGGGTTGCTTTTAAGC
ACCTTCTCGACCACAATAGTCTCGCCACTCTCTGTAGGATGCAGTTTCTTGGCAATACCCATAGAGATACTGGCGAGATGCTCCATCATGATCTTGACCG
TCTCTGTCTTGCCTGCTCCGCTCTCTCCGCTCACGAGAATACTCTGTGGAAGGCGATGTTGCTTCATGTGGTGAAAAGCTTCAGCACTGGTCGCGTATAC
GTGCGGGGGCATCTTATCCCAAGGTCTCTGTGTGTACAAATCACGTAGCTCCTCCGAGTAATGCTCCTTGATCCACTGGTACGGATTCACAGCCACGACA
ATCTTGCCTGTATATGTGTATGGCTCCTTGGCGTAGAAGCGTTCACGTACGTTGTAGACGATGGCAGGTTCGTGGAGATGGCCCAGTTCGCACATGTCCT
CGGCCCCGACGCTGTGCTTGGTCTTGGTCTCGTGCTCCTCGTCTCCCTCAGCTGGGCCATTCTGTAGTGGCAGCGAGTCGGGCATGTTGTCCTCGTTCAG
ATCCACCGTGCGCTCCTCTGCAGGAGCGTCTTGGTCATGGCTGGCGTCTGAAGCGTCAGGCAGAGGCTGCACACGCACGCGGAAGATCTTGCCGCTCGCA
TCCACCGACAGGACGGTGGCCGGCACCCACACGAGCTTCTCGTCCGGAATGAAGACGCGGATCCCCTCCA