Description :
From Genome Similarity Track
Location :
Scaffold_201:9956- 11222
Sequence
1266 bases(100 bases per row)
GGCGCACCCAGGTGTTCGTCGTACACAGCTAGCTGCCGCTCAGTGGTACTTCTGGCCAACCATGGATGCTGACATCAAGGGCTACGTTCAAAGTTGCGAG
TCGTGTATGAGATACAAGTCGAACACTGGACGCAAGGCAGGCAAGATGCAGCCAATTCCGTTACCCTCCGCATGCTGGGACGTCGTCTCGACCGACTTCA
TCACGCACTTGCCAGTATCTGATGGCTTTGACGCGATCATGGTCGTCGTTGACAAGCTTTCCAAAAGGCCAGTCTACATTCCTACCCACACGACGGCAAC
TGCGGAGGATACGGCGACGTTATTCTTCAACAACGTCATTCGGCACTATGGCATTCCGTCGACTATCATTTCCGACCGGGACCCAAAGTTCACATCCAAA
TTCTGGAATGCGCTGGTGCGTTTGATGAATATCAGGACGGCAATGACCACTCAGCATCGAGCTCAAGCCGACGTCCAGACGGAACGTCAAAATCGGACAC
TTGAAGACTCTCTACGTTGCTCAATCTCTTACCATGGGAACGACTGGAACGAACACTTGCCCATGATCGAGTATGCTCATGCAACATTGGTGTCGACCTC
GTCGAAGCTGCCTCCGTTCTTCGTGGACACCGGCCGTCAGCCAAAAAATCCGTTGGGTACCAGGCAGGACACTGAGCGAGTCGCAAGAACACGAGTGGAG
TACGCTTCGCGCTTCGTTCAGCACCGGCAGCAAGTGATTGAGCGTGCACGAAAGAACCTTTTGGAAGCCCAAGCGACCCAGAAGAAGTTCTACGACAAAC
GACGTGCCGAGAATCCGTTTTCAGTGGGTGATCTTGCTTTACTCTCGACGCAGGACTTGAACATCTCGCATGCGACAGCAGAAACGACGCTGAGATCCCG
AAAGTTCATTCCACGCTTCATTGGTCCGTTCCCCATCGAAGAGCTCCGAGGCAATGTTGCACTCCTCAAACTACCAGCCAATCTCAAACACTTGAGTCCA
CGCTTCAACATCGACAAGCTCAAACCGTACACGAGCAATCCAAGTCGCTTCGAAGGTCGGTCCATTCCGAAGTCGACGCTAGTAATTTTCGACGATGACG
GCGAGCCGCTGCATGTCATCGAGGCTCTGATCAAGAAGCGCATCTTCAATCGTCAGCCGGAGTACTTGGTGAAGTGGCACGGGTTACCACATCACGAGAA
CAAGTGGGAGCGAGAACGCCAGATCAAGCACGTGAGCCACTGGCAGGCACTGCTCAAGGACCTTCG