Description :
From Genome Similarity Track
Location :
Scaffold_29:995495- 997472
Sequence
1977 bases(100 bases per row)
ATGCGCTACGCTCTGATCAAATTCAGAGTGTACTTACTTGGCGAGCAAACCTTCGCCGTGTATACCGATCACGCATCGCTGAGGACAGCGATGAAGAGCC
CTCATGTTTCCCAGCGAATGGCTCGCTGGTTGTCGTTCTTCTCCGAGTATTAATTCGTGGTTCACTAAAAACCCGGCAAGAACAACATCCTTGCCGATGC
TCTGTCTCGTCGTCCAGATTACGACCCACGCGATTCGCTGGGTCAACAACCGCTGCATGATGAAGACGACGAAGACAACTGTGCTATGTGCTTGGCGTCG
GGATTGAACCTGACGAGCGTGTCTCCAGAAACCCCACTCCGCGACGAAATCCGGACTGCATATGAATTCGATCCGGTCTATTCGAGTATTCTGGAACATC
TCCGCTCGCCCAGTGAAAAGACACTGAGTGCAAGACACTGAGTGCTTTGTCCCGCTCCACACGCCATCAGATCGATAGGTATCGGATTGAAGACGGGCTG
TTAACGTACAGCATCGATCGCTTCGATGCTTCGCGTGTGGTGGTCCCCAACGACCCTGACTTGCGCTCGCGGATCATCCACGAGTTTCACGATATCCCCC
TTGGCGCTCACTTGGGCCGTGAGAAGACATTCGCCGCAGTGTCGCGCGACTTTTACTGGTCCCACATGTATAAGTGGGTGCGCAAGTGGGTGAGGACTTG
CGAGATCTGCCAACGCGTGGAACCGTCCGCGGCAGCGCAGGCTCCCCTGCGTCCTTTACCAGTGGCCACCGAGGTATGGCGCTCGGTGTCGATGGACTTC
GTCTTTGGCCTCCCACCCGACTCCGCCGGGCGCTCCGGTGTCCTGGTATTCGTCGACAGGTTCAGCGAGATGGTTCACCTCATCCCGGTCCCGGATACGA
TCACCGCGGCCGATACCGCGGTGCACTTCGTGGATGCAGTCTTCCGACATCATGGCATGCCCGAGTCTATCGTTTCGGACCGCGATCCGCGGTTCACGTC
TGCTTTCTGGACGAAGCTCTTCGAGCTATCAGGGCCAAAGCTGCTGATGTCGACGGCTGCTCATTCGGCGATGGATGGCCAAACCGAGCGAGTTAATCGC
GTCCTTGAGGACATACTTCGCAGCTATACGACGTCGTTCACGAGCTGGAGCTCGTTCCTTCCGCTTGATGAGTTCGCGCTGAACAACGCGGTTCACGCGT
CGACTGGCCTGACTCCTTTCTTCGTCAACAACGCTCGGCACCCTCGCTTTCCAGCTCTCCTCGCCGTGGGCCGTCCCACGCCGCCGTGTGGCTCCACTCT
GGGTGGGGGTGAAAGAGGCGACAACCACTTTGTGACGACTCCGGTTTCGAACCCACAACCGGTTACCATACCGGTTGCCGACAAGCCTTCTGCGCCAACA
CCGGTAATGGACCCTCAACCGGTTTCCATACCGGTTGCCGACTCCTCCTCGAGTGCAGCCTCATCTTCAGCGCCTGTTAACGCAGTGACACACGCCCAGG
CCAGGAAGGCCCTGACGACTCCCCGCGACGCAGTGTTCCCTCTCGCCTCGTGGACGAATCGTGCCCTGATCAGTCCTGGCACCGCTAACGCGGTGTCTCC
ATCAGCGAACTACGCGCCAAAGCAACCGGCACATCCGGCTGATAACACCGCTGTCTCAGACTTCCTCCTCCAGCGCCAAGCAGTCACCCGATACGTCCGC
GACGCGCTGCAGACGGCGGTCGACAAGCAGAAGGAAAACGCGGACAAGCGCGGCCGCAAACACACAGTAAAGTTCGCGACAGGAGATCGAGTGCTCCTAT
CGACTTCAGGAATCCGAGACTCTGCCGTCACCAACCTCGGCGCGAGTAAATTCGCACCGCGCTTTATTGGGCCATTTACGGTGACTAAGGTTATTGGCGA
GGCTTACACACTGGATATCCCCACGTCGCTGCGACTACATCCGACGTTCTACGTCGGACGACTCAAGCAATACCTGC