Description :
From Genome Similarity Track
Location :
Scaffold_419:99547- 100793
Transcript NameFunction/comments
Aphin_H310_00863NHL repeat containing protein

Sequence
1246 bases(100 bases per row)
GTCGCACCCAACACGTGCGCATGCATCCCAGGCTACAAAGGATTTCCGGCATGCGACGTCCCCATTTGCGTCCAAACCTGCGTCCACGGTCGATGTGGGT
TTCCAGACACGTGTGTGTGCGCGTCCGGCTGGTTTGACGCCAACTGCACGACACCAGTGTGCAGCCAGACGTGCGGCAACTTTGGCAATTGCACCGGTCC
CAACACGTGCACGTGCACACGGGAGTGGCAAGGGCCAGACTGCCGCACCCCGGTGTGCCAACAGACCTGCGTCAACGGTGGCGTGTGCTCGGCTCCCAAC
ACGTGCTTGTGCCCGGCAGGTTGGAGCGGCCACGATTGCGCCATCCCGATCTGCACCCAAGGCAAGTTTGTCGCTCACCCTAGCGGGTACGAGTACGGCT
TGTTCCGTCCGTTTTCGTGGGACGAGTTCGCTCCGTGCGAGTTCGACAAGTGGTGCCAGTCGACTGTTGGGTTTGACTGCGCTCATCGACCGTCCGTGTT
GCTGGAGCCGCAGTGTTCGTTGATCGAACTTCGACCGACCGCGTTGAGTGCGTACTCGTATGCTGTCGAGTTAGCGGATCGGACTCGGTTCATGCGGTAC
TCCGCCGCAACGCCGTACGGCCAGAATCGCGCCAACCTGACGTATCCTGGAGCTCCTGTCCTGGTGGCGGGACCGTACAACACGCCACCGTACGTGGCGA
CCGTCGATCGCATCCTCGCACATGTCGAACGCCGGCGAGTCACGCAGGGAGTGTACGTGTGTGCGAACCAGGGCAACTGCACGGCGCCAGACATTTGCGT
GTGCGCGCAAGGGTGGAGTGGGTTTGATTGCCGCACACCTATCTGCACCCAAGGTACACAGCGCGCATGCGCCGGACGTTCATAGAATTGTAGGGTACTA
CACGCCGACGCAACCGACGTTCGTTTCCGCCGAGCCTGTCGAGAGCAAACACGCAAACCACCCGACGTCGAACGGGAATCCGGTGTACCCCCACACGGTG
GAGACATTGTTTTGGGACCACTACACTGTCGAGACGGTGCCCCAAGGCAACGCGCGGTTCCTGTCCGAGGGGTCTGTCGCTCAAGGCGGGTACGCATGCT
CGTCGCGGAGCCTGACGCAGTTTGAAAAACCCGCGACTGTCGAGTCCCCGGCGTTCTACTGGGATTTTGCAAACTACTTTTCGCACTACATGAACGACAC
CATGTACTGGCCGCCGCTGTACACGAAATCGCCGCCGATTTGGGAC