Description :
From Genome Similarity Track
Location :
Scaffold_7:99535- 100823
Sequence
1288 bases(100 bases per row)
TCCGCTCTCGGTGTCAACACTCCCGGCGCAGAGAAAAATAATTTTACTGCCTTCGACGGTTGACTTCAGCGCTTCAAGGAGCGCCACAACATCAAGTCGT
ACCGTCTCCATGGAGAGGTGGAAAGTGACCCACTTAAAGACCTTCCTGCCTTCCGACTTGAGCTTAAGAATTTCATCGACAAGTTTGCTCTCAACTAGGT
CTTCAAAAGTAATGAAACCAGGCTGTTATATCGCATGTCTCCAAACAAGACACTGGCGCAGCGTTCAGAGAAGGGCTACAAGAAGGAAAAGGTCAAAATC
AATGTTCTATTCGGATGCAATGTATCAGGTATGTGCTTTCAGCGTCATATAAAAACTAGTGATTTTTGCTCAAATATCTTTTTGTAGGCTCTGAGAAGCT
CAACCGCTGATCAGTGGGACTGATGTCAAACCGCGTTGCTACCTCAACGTTGACATGACGAATCTGTCCCATGTAAAGTATTTTACAAATAGGAAAGATT
GGATGAAGAGCGACGTGTTCAGGCCTTGGATTCTTGGCCTGAAACGCTAGTTCCAACGCCAGGGCCGTAAAATCCTGTTGCTGCTGGACAACGCCAGCTT
GCACTCCGTGGAGGACTATGAGGATCAGATGAACAACATCACGGTCAGTGTCATGAACTGTTCTGCAACAGAGCTTTAAATGCTGACTATCCTTCAATTT
GTACACAGGTTCGATTCCTCCCCTCAAACACCATGTCCCATCTGCAACCGGCCGATGATGCCATCATCACCAAGCTCAAGTACTAGACGCGCTACATTAA
GTACTTCTTGGAGAATCTCGACGCTACTGGTGATCACCCTTTTGATCCTAAGTACTTATTCACCATCCGCTAGGCAATTGATATGCTCGTCGAGTCGAGG
GCGACGTTCCATCTGCATCCATTCGCCATTGCTGGAAAAAGACCGATTTTCTTCTCGCTCGAGGTCGCATAGTCGTCAATTCTCAACTCAACACTGAAGA
CGTTGATCTGTCTAGCCAGCTGTCAGCTTGTTTAGCAAGAATCACACAGCACAATGTCGCCGCCACAATGGATGCTCAGATATACCTTCAAGTCGACGGC
ACTCTGCTATCATTGAGAACCTCACCGATGAGGAGATCCTGGCGGAGGTATCGCCGGATCAGACCGTGGCGAACAAGGATGATGAGGATGATGAGGAACT
TCCAGTGTCAGTACCCTGGGGAAGGATGCAGGAAGCTGTGGAAATTTTGCTGGAGGGCATGCTTGAGAAAGGCGATCGATTCGACCAT