Description :
From Genome Similarity Track
Location :
Scaffold_4:995309- 996792
Transcript NameFunction/comments
Phyin_T30-4PITG_03202Putative uncharacterized protein
Phyin_T30-4PITG_03203Exocyst complex component 4%2C putative

Sequence
1483 bases(100 bases per row)
AAGTCTGAACACCAGTGATACACAAAATAAAAGTTTACTTTATTAAAAAAATCAGAGTTGGTCGGTCTAGTAGAACCCTCGATCGGCGGAATGGCCATCT
GCGAGCATGTGAGCTATCACCCCGTTGCCATGACGCACCGCCAAGTCCAATGCGGTGGCGCCTTCCTGTCGATTTGACAAAACACAGTTACATGTATCCA
TTTAGTCTTGGCTAGCTGAAGTCAAAAGTGACCTTACCGAGTTGGTGTAGGTCTTGTCGGCTCCGTGTCGTAGCAGGATCCGTGCAATGTTGTCGTGGCC
GAAGAAAGCAGCTTCGTGTAGTGCACTGAAGCCGTCGGACTGGTATCAGAAAACCCCTCATTAGTGGTGGCATTATTGCAGTAGGTGTGGATAAGTGTTG
GCGGCTGACATCTCTCTGGTTAACGTCAGCTCCTCTCTCCAGCAAGAACACCACGCAGTCATCACAACCCTTTTTCACTGCAGCTTGGAGTGCTGCGTAT
CCTTCTTTCTGCACGATATGGGCGTTAAAAGCAACAACTGCACGATACTGCGGTTTAACCCACGTCGGTATCGTTGATTCGAGCGCCTTGTTCAAGCAGT
GCCGCTAGCTCTTTCACGTCCCCATTCCCTGCCGCAGCTACCCATCGATGTCATCATGAAAATAGTGTTTCAGTCTTTGCTATTTGGATGCATACAAAGT
AACCTGTAAAGAGCTCCTCGATCTTCACGAAGCTCATGGTCGATACTTCCGATTGTAAAGACAGAGACGCCTGTTTCATTTCGGGAAAAGGCGTCAGCTA
AAAAGATCGTCACCATGAGCGTGATCGACCCCGTTTTCTTTGACAAGAAGTTTAACGTGTCGCGCTACATGCTGCGGTATGTGGTCGGCGCCGCAACGGA
CGAGCTTCGCGACCAGCAGCTCCAGAAGGTGCGAAAGTTTCGTGCCATGGCCGACAACCAAATCGACGGCGTTATCGACCAAAGTTTCGTCAACTTCAAC
ACAAGTCTCGCTCGCTTCACAACCATCGCGAACCAGCTACAAGGTTCGCCACCTCTTCTCGATATAACTCTACCGCAGCCGCAGTCCGTGAGTGTTCTTG
TGTCATTTTTCCCTTTAGAAACGCGGAACAAAGTACAGGAAATTCGTAAACGAGCTGCTGATGGACGGACGATTCTAGGCTCCAAGACTAAAAACTTACG
CGAGTTGCTGCTCCAGAAGTACGAGGCTAAAAAGGTGATCGACATTATCAATGACATCGAGTGCATTGAGGCTGCACCGGCGAAGATTGACGCACTTTTG
ACCCAACGGAAGTTCCTCGAGGCAGTTGACGAGTTCGCAAGCGCATTGGATTTGGTCTTTAGCGAGCAACTCGTGGCCTTCCACGCCACCACAGGATTAC
GCAACGACCTGATGGAGTGCAAACAAACCATCGAAGATCGACTAGTTCAGGAGCTTCAGAGAGCTGTATACCTTAAAGGAGCG