Description :
From Genome Similarity Track
Location :
Scaffold_792:9953- 12735
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_792-fgenesh-gene-0.3GPI anchor protein
Pytve_DAOMBR484maker-pve_contig_792-snap-gene-0.12Deoxycytidylate deaminase

Sequence
2782 bases(100 bases per row)
GCTCCTGCTGCTGCTGTTACGGAGGCTCCGGCCCCGGCCGCCACTGATGCCGCGGCGACGCCTGCTCCGGCCACGGACGTCAGCAACGGCGACAACTCGA
CGCCGAGCGGCGACGACGGAGACGACGACGACAGCGGAGATGATGACGGCGACGACGGCGACGACGGCGCGTCGGCCTCGACGCCCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGGACAGCAGACAGCGGCCGGCACGGTCGCGAACGTGATGTCGTTCACGGGCAAGGACTGCGGCGG
CGCCGGCGGCACGTACGAGAAGGTGACGGAGATTGGCTCGTGCGCCAAGACGACCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNACCCGGTGTCGCCCTTCGACGACGACGTGACCGTCTCGTTCCGCGGCCCGATGAACATCTACAACATCGCCGTGTTCGACGGCTCGAGCGGCTCG
AGCTGGGACCGCGTGTCGTGGTACGAGAACGGCGGCAACGCCGAGAACATGGTCTTCCTCAACAACCACAACATCGACTACACGGGCGGCGGCTCGCCCG
AGGGCTTCGCCACGGCCGACGGCACGGGCACCGCCACGCAGTCGACCCCGTTCTCGGGCTCGCTCGCGGCCGCCTCCAACCCGTACGGCTCGTCCATCTA
CGCCGAGGACAAGACCGGCGCCGAGGTGCACATCATGACGGGCAAGCAGTGCGGCGTCGACGGTGTCGAGTGCACTGGCGCGTACGACAACGACGGCACG
GCGTTCCAGGGCTGGACTGGCGCCAAGAAGCTGTTCATCACCAAGGTGGACATGCCCGAGGGCGGCGCGCCGAACGTCCCGGCCATCTGGATGCTCAACG
CGCAGATCACGCGCTCGGGCCAGTACCAGTGCAACTGCCGCGGCGTCGGTCCCGCGGGCGGCTGCGGCGAGCTCGACATCGCCGAGGTGCTCGAGAAGGA
CACGAGCGTGGTGGCCACGCACTACTACTTCTACGACGGGTCGGTGAACCCGGGCAACGACCGCTTCGCGGCTCGCCCGACGGACGCCCCCACCACGTAC
ATCACCATCATCGACGAGAGCTACGGCGTCAAGATCATCGAGATCGGCGCCGACGACTTCGACTTCACGAGCGCGAGCATCTCGAACGAGGTCGTGCAGC
AGTGGGAGCAGGCCTAAGCGGCTGCGCGCGTAGACCGTTCCTTGGTCGCAAAGGAACAGAACGGGTGGCGTTCAGGCATGTTGTGGACTCGAGCAATATA
TATCTGTGCCAATGACCCACCATTGCCGCGTTGTTCGAGTTGATAGCATTGTTCATTTCGTGGAGTAGCTGAACATGGCTTTGATGTGGTTTGCGAACCT
TTGCTGAGTTTGTTGGCTCTTCATTCGACTGCCGAAAAGTCAATCAGCACGTGGGAGCGGTGGAGTTGGTGCTGTGAGCACTTGACGCCCGCCATGTCGA
GGAGGCGGCGCGATGCGACAAACTTCCAGCTACATCCACAGCACAGCATCAAGTCAGACAACCGTCAACGCCACCAACCTGACAGGATCACGAGCACTCA
CTCGTCGCGATACTTGTCGGAGCAGTAGACGACGCGCGAGATGCCGCTCTGTTGAGCATCACACAGAGAGCGACAATGTCAGGAGATGGTCGAGCATCAC
ACCGACAGCAATACCAATGCTAACTCACCTGAATGATGAGCTTGGCACACTCGTTGCAGGGGAAGAGCGCCACATAAATCTGCCACAATCACCATCATGA
GAATCGCACAACGGGAGATTGCTGTCGTATTATCCTCGTCATAGAACGCACCGTGCATCCCTTGACGTCGGTTGAGTTCTTGTTGAGGATTGCATTCATC
TCAGCGTGGCAGACGTACTGTTACACATCGAGGTAATCAGCGAGAAGGTTCATACGAGCGGGTAGCGAGGAACGCTATCACTGATCTTACCGGGTATTTG
GTCTCGAGCGGAGAGTCGGAGGTGCTCGAGCGAGCCCACGGAAGCTGGTCGTCGCTGCAGCCGTTCGGGAACCCGTTGTACCCGATGCCCACGATCTTCT
TGTCCGGGTTGACAATGCTGCGAGGAATCACACCGCCACTCGGTCAATACTGCACCTACTTTGTTATCATAATGCACAATGCGTACGCACCAAGCGCCGA
CTTGCGTTGACGGATCTGCGAACAATCATCGCGTTTGAAGTCAGCTGGTAGCAATAACAAACCCAGATCGAGAGCACCATCGCCTCACCTTTCGACCGCA
TCGCACTCAGGAACGCGACGCTCATGAAGTAGTCGTCCCACGACAGGTAGTCAGCGCGCTTCTTTGTGCCGCCATTTGCCTCGTCAGTCGCTGGCGTGAC
CACTGGAGTCGCTTCGTTGGTGGCTTCCTCTCGCTTCTCCTCATCGTCGATCGCCGTGTCGGTTCGCTCTGTCAGTGGCGACGGCGTAGCCACTCGCTCA
TCGCTTTGAACGCTCGGAGACTGACTGCGAGACTTGGCGGGGCTCTTGCGTCCTCCATTCATCTGGCTCGCCGCGGAAGGCGCGGGCACGACGTTCGCAT
TCCTCACCGCCGCCGAGTACCAGTCCTCGTGCTTGACCAGCACGTGCTGCGACAGGTTCGTGTAGCCGTGCTTGAGGCTCTGAGCGCGGATCTTGCCGCA
TCGGCAGCGGAACTGCGTCACGCCGTCGGCCGTCTCCACCTCCGTGAAGAAGAGCTCCTTGATCTCGCGGCCCGAGAGCTTG