Description :
From Genome Similarity Track
Location :
Scaffold_378:9953- 11817
Transcript NameFunction/comments
g16503.t1XP_009530061.1 hypothetical protein PHYSODRAFT_334506 [Phytophthora sojae

Sequence
1864 bases(100 bases per row)
TCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCCGAAAATGGTGACGGCGTACGAAGGCCGCCAC
CGCCACCTCCGCCGAAGGGCGTAAAACTTGGACGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCGGATATTCGCAGCACTAGAAGACGCCTG
CACCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACATCCCGCTCGGTGATGCGTAATGCTCCAGGGTAG
CAATACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCT
CGTAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTCTGACAAAGTGCCTGCCA
CTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGGTCCGTCATCGGA
TCAAAGTGCAATCGCTTCGCGACGTCATCGTCAACGATGGCGTTGCACGAATACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCTGA
TCTCAAACTGAGACGGCATCCACGGCTCACGCACTCGCTCAGTGCGCGAGGCCGCAACAGCAGCGGATGGAGTGGAGTCATCTCCATCCCGCGGAGTCGA
CAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCCCGAAGCGTTCGAGTCGTCCTCGCGTGGACGACGCAGACCCACA
TTGGGGTCAGTGTGGCCCGGAGACAATGTATCCTTGTCTCCCTCGCGTTCCCCCTCCTCGACTTCACTCCCATAGTCGAAGGGAACTCCCTCTCCACCAG
GAGAGTAGATATCCACTCCGGTTTTGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCATGCCATCTCGAGTGGTATCCAGCAACAGA
GAGGCGACTCTCTGTTGCCGCGCTTGTCGGCATCGCCGTCGAGGCGATGTCAGTTGCGGTCGTGACAGAGGCAGCGGCCGTCGTCGCCTTGGAGGCGACG
ACAGCACTTGCTGTTGCCGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCTCGAAGAAAATACGGAT
TGACGTGTCGAGACCGGCACGTCAAATGCTAACGGGGGGATGGTGTAGCGGGGCTACACATTTGGCTCACCTCCTACCTTAGTGCAACATGCACTAAGGG
ATACATTCAGGTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAAAGTCATTCAAT
AGATAGGGGTTCTGCCAGCCATCCGATGGCAGAATCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGC
ACCAAAGCTATCGTTCGGTCCCTTTGTCTTAGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTTAAATACACCTACGCTTCCTCATACACG
TGCACACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACTCATTACAACAGGGCTCGAACGAGTTGGGGCCGCCGTTGATCTCGCAGGCGGCGCTGTGG
TCGAGGTCCTCATCATGGAAAGCAAATGTGCATTGCTCTTTGATTTTGTATGGGCTGGCGATCA