Description :
From Genome Similarity Track
Location :
Scaffold_94:99512- 102270
Transcript NameFunction/comments
Physo_141108hypothetical protein

Sequence
2758 bases(100 bases per row)
TTGAACCACAACATGGAAGTTCTTACTTAACCTAACTAACATTCAGCATCGCAGTGAGCTGCAAGCTGCCCTGAGTTGATCGAGGCATCCATAGCAGCAG
TGAGCCGCCACCTGTGCCTGGAAGGCCCAGGAATCCGGGCCTCCACCGATCCAAGTACAGCGTCTTGCCTCCCAAAGCAGTCACATTCGACCTCCACGTC
GCCGTTTTACCGGCCGGGACGTCCACTTCGTCGATCTTGTCACCGCCAGACTTGATATTCACCGTCACGTCTTCGGTATCGACACTCTTAAACGTGATCG
TAACGCTGCCATCGCCAACTTTCGTCCACAAGCCCTCGCTCTTGTTGAAAGCACGCTGAACGGTGGTCAGGCCCAGCGCCTTGCTCGCTGGTCCGTCGTC
AATTTCACCGACGTATTCGGTCGGGCCACAAATGGACTGGAAGTACTCAGAGATGACACCACCAACAGCCCACATATCCCAAATGGCGTAGAATCCCGCG
GCCTTGTCAGCGACCTTAAACGCGTACTCCTCAGCTTTGAGAAACGTGCCGTTGCTGCTCGTTCCTGAGGTGATCAGATCCTCGACGATACTCCCGAAGG
TTTTCCGCAGCGTATCTCTCGTAGCGTAGGCTTTTTTCTCGTTGGACTGTGCGATGAGCTCGTCCATGCAGTTGTTTGTCGCAATCGGGATGTCATTCAG
CACGAGAGTCGACTTGCTCATAGCAACGCGAATGTCGTTCTCAGACATAGTCGGGTTGTGCTTACGGAACTCTGCGATTGTCATCCACGTGCGATCCAGC
AGTCGCTTCATGTCGTAGCCGCAAGTTGAATTGGATTCCAGCGAAGTCTTCAAGTTGGTGATGTCGTTTTTACCGAGAGACTCGACCGACTCGTTCATTG
AAACTTTTTTCAGGAAGTTGGTGAAGTTTCCCCAGCTCGAAACAATCTCGTCGGGGTGCTTCATGACCTCCCTCAACGTCAACTCAGCAGTGGTGACGAT
TCTGTCAGCAAGCTTCACTTCCTCCGGAATCTTTTTCCCCATACAGTACCTGACTGCCACCGGAATGTCGATGACGATGTTGTCCGTCTGATAGAGAATC
GCCAGCAACTTTTCTTGCGAAGTCTGGGGGTCGGACACCTTAACGTAGCGGATGTATTTGACCAGCGACTTGGTCAAACCCAACCAGGCCTTGACACACT
TGAAAGCTCTCTGGAATCCCTTCGCCAACTCCCAGAATTTGAAGAACACACCCATGGTAGTATAGGACATCATGGCCTGGATCACCGTGAAGGCTTTGGT
CGCGACTTCCAGCCCACAATCATCGTTCCGGCGGATGCACTCCATTCCACACTTGACGGGGTACGAGTAAGGGCATTGAGCCCAGCACATTCCGAGCTTG
TAATCGTACCCGATAGGGCAGTTCTTCGTGATGTGGGTCTTGCGGTAGCACGCCGAGGAAAATGAAATGTCGATGTCGCCCTCCAACCCCACCCAGTTCG
GGTAAGTGGGTTTGATCGTGCTGGTTGCGTTGACGACGCTGCCAATCGCGAACTGAGCGGCCGTGGAGCCCGAAGATGCAGTTGAGCCACTGATGGTCCC
AGCTTTGCTGTCAATGCTGTCGGACGATTCGTCGAGGTCACTTGTCCCGCCATCTCGATCGTCGTCACTCGATGCATCGGTTGAAAGCTCAGTTTGGAGT
ACGCTGTGTACAGAGTCCTCACTATCCGGAGAGTCCTCACTGTCCACAGATTCATCGTCGACGCTTGAAGATGAAGCTCTCTTTAGTCCATGTACTCCTG
CGGTCGTGAAGTTGTCGTCCGAGTCGGCGTCAGCGGGCGCCACCGTAGCAAGCGGGTTGGACGTTCTGGGCCATCCACCAAATGTCAGGATCTTGGCCGA
GGAGAGCCCAGCGAAGATGGCTACGAAGACGGCAAACAGTACAGCAAGCCTGGACATCCTGCCGAGTCTCGCTCGCGAGCGCGAGGAAGCTTGTTGAGCC
TCGAGAGGGGCGAAACGGAGAGTGAGAGCGAGCGGAACCCTGCTCCCGATACTTTCTTTGTTGCGAGAGCTGGCTGCTGGCCCGGCTTGGATGGACTTCC
TTGCTCAGCTACCACGGTACAGAATCTTGAGCTTGTCAGCGTTGTAAGCAACAACGGGGTCGGTAGGATAGGCTCCGATTTCACCAGATAAGCATGCTTA
CCGTGTTGTAAATCAATTCCGGTGGACGTGTCCACCAGTGTACAAGCGGTACAACATTGCACGGCTTCAACAATACCACGGCAAACCCTCCAATCATCTT
GGTGCAATTTCGGAGACACTTGGCCGTTTGTGCTCGTCGCTGGCAAGCACTGCTCCGTTCTCGAGCTTCTGTGCAGCCATCTGTGGGAGCAACTAAAAAT
GTGCAGACGCACACGCCGTGCTCGTCACAAAGCCCCTCCTCCAACCACCTGCTGCTTGCTTGAAATATCTCGTCGCTGGAGCTCAGCGAGCGGCTCCGCA
TGGTGTGACGTGGAGACACAAGATGCAGAAGGGGATCGGCGCTGGCCGTTCTCAACTAACGATGATGTGCAGAGCGCGGTGCGGAGATTCGCTCGTGATG
TTGCGAAGCGCAGCCACCAGTGCTTTTTGCGACTGCTGCAAAGCGCCGTGGTTTAATTGTGAGCTTCGTTGACGATTTGCATCGACCTTTCCGCTGTTCG
ATAGCCAGCTCGGCTCGGCTCCCGAAGTAGACGAGCGAGCGGTCGTCGGTCTGCAACT