Description :
From Genome Similarity Track
Location :
Scaffold_181:9951- 12123
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_181-abinit-gene-0.49Regulator of chromosome condensation (RCC1)

Sequence
2172 bases(100 bases per row)
AGCGGAAAGGCAGCACCACCTCGTGCTGCAAAATCTCCTCTGCCAGCGGCCGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCTGGATGCA
TCATGCTCGCGATCAGGTGCTGCAGCGAGTTCGAGTACTGACTGCTGAGGTCAATCACAACAAACCACCATTTCATACACACAATGAGTGAGTCTCAGGG
TTCAAAGCTCAGCCATTCAAAAAAACGTCGAAAAAGAGAAAGAAATCGTACCGGAACATGACCAGGTCGCCGTCTCGGATGCGCTGCCAGTCTTCACCGC
CGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCAGTTCGTAAATCGTGGCGCCGAGAGCGAAAATGTCGCCCGCGCGCAGGTTCGTGC
GGCTTCCCTCCATCAGTTCCCTATTCATTAACAAAAATCAGAAAAAATAAGTATCAGAAACAGCCAGCAGTGCTCAAGACAACTACAAATCTCCTTTGCA
CGCACCGGCTCAGATATCGGTTGTCACCCTCGGTGATCTCCATGCTGCCGTCCATGTGCGCCACTGTGCCCAGGTCCCCCAGCTGGATATACCACCAGCA
TCGCAATATGTTAAAACTACCACGTCACATTTTCAATAACACAACAGCACATTTATTTGTACCTTGTAAATCTCTCCATCAGCGACGAGCACATTCTGGA
TTTTCACGTCCATGTGGACCATTTTCTTCGAGTGCATGTCGTGCAGAGCCTACAGCGACACACATTCGCAACATGTCAGTCATTTACAGACATAGTGATT
ATCTATTGTAGAGCATGCTGTCCGTACCTGTGTGATGTGACAGAGCACTTTGCAGAGCACAGCTTCGGGGATGTGGTGGGGCTTGAACTTGTTGAGGAAG
CCGCCGAGACTGCAGCCGCTGCAGCTCTCCAGCTGGATGTAGAGCAGATCATCCTCGATCCACGCGTCAAAGTACCGCACCACGTGTCGACTCGAGCTCA
GCGCTGCCAGCGCTTGGACTTCTCGCAAGGCTCGCTCCCTGTACATACGATTCAAAATATGAATTGGTGCATATTGCGTCTCAAGAAAGGTCATAATGAC
AAAATACAAAGAAGGGCTTACGTGTCGGCTTTGCCTCGAAAATGGCGCTTGCTCTTCTTCACCGCGTACATCCAGCCGTCGATCTTCTTCATGCACTTGA
ATACTTTCGAGAACGAGCCCGAGCCAATGAGCTCCAGCTCGCTGAAGTCCGCTAGGTACTTGGAGAGCGGCGCTGTATTCAAACCACTGCCCCAGGTGGT
TGGGAACGACTGGCGCTTGCGGTTCGAGCGCTTCTTCTTCAAATCTGACGCGGGGGTCGGTGCAAACGGGTTCACAAACGACTCCATTACCAGAAAGCTC
GTCTTGCTGCTGGTGCCCTCGTTGCTACAGATGGGTATAAACAATAGGACTTAGCATTTGACGACCCATTTTCCTCCAGAGCAATAGTGTAAGGCGTGAA
ATGGGGCGATGCACAACGTACCTGTTTGGTCGAGATCGTCGCTTGCCTGGCAAGAAGCTCTTTGCAGGCGTCTCTGTGAACTTATGCGGCGTGGGCTGCA
GGAAATGCCGCGGTGAGGGCATCGAGTCGCTCGAGAAGCTCGGCGGCGGCTGCACACCCATTCGGTGACAGACATCCATGTGCGTCATGTCCTGCGTCAG
GTTCTGCACTTCTTCTTCGCGGATCCGGTCGACGCCAAAGCCAACCGCATTACCGTCACCATCATACTCGTCGTCGTTGCGTCGCTGGCGCTTCTTGAGC
GGCGAAGGCGTCGTCGGGTGCGACAGATGCATCACAGGCTGGTCGAGCGGCGTGAGGAAGTCCATCTCGTCCTGGCTATACATGCGGCTGAAATGCGGTG
CTGACAGGTTCTCGAGAAAAAGTCCCTGCTGTGAGCTCACGACAGATCGCCCGCCGAACGCTCCGCCACCACTACCGAATCCACTGCCTGGTATTTCATT
CGGCTCTCCGTCAGGCTCGCTGCGCTGGCTGGAAAAGTCGATCTTCTTGGGCTTTGGCTGGTGGCTATTATCGAACGCGACCTCGCTGGTCTGCGACGCT
GAGTTCGCCTCGCTGCTCTCGTCGTCCATGCCACCCGAGCTGGACGAGTCGTAGTCAATGCGCTTCATCACA