Description :
From Genome Similarity Track
Location :
Scaffold_2501:995- 2517
Transcript NameFunction/comments
Phyta_totarag14558hypothetical protein PHYSODRAFT_262200
Phyta_totarag14559hypothetical protein

Sequence
1522 bases(100 bases per row)
GCGAGCAGACGTTTGCACTATACACCGATCACGCATCGCTGCGGACGGCAACGAAGGACCCGCATCTGTCACAGCGATTGGCACGGTGGCTGTCGTCCTT
CACCGAGTACAACTTCGTCGTTCACTTCAAGCCTGGGAAGGCGAACATTCTCGCCGACGCGCTCTCGCGTCGGCTTGATTTCGACCCGCGATCGGGGTCG
TTGCCTGCAGATGACTtcgacgatgaggaagattGAGCGGTCCGCATAGCCTCGGGCGTCAACGCAGTCTCCGTTCGCGCCGTCTAGACATTGCGCGAAC
AGATTGCGTCCGCCTACGTCACGGACCCGTTCTATTCCGGCGTCATTGCATATCTCCGTGACCCTTCGGAGTCAGCACTGTGTCGACTGACAGCGCCCAT
GCGCCCATGCGCGCGTCGATCGCGCACTACAGCCTCGACGACGCCTTGCTGATGTGCAGCTTCGACCGTCACAATGATGTCCGtgcacagcttcttcacg
agtACCATGACAGTCCTAGCGGCGGACACCTCGGGCGTGAGAAGACCTACGTCGCGCTCTCGCGCGACTTCTACTGTCCCCACAGGTACAAATGGGTGCG
CAAATGGGTCCGCTCCTGTGAGGCGTGCCAGCGAGTCAAGCCGGCACCGTCGTCGCAGGCCCCGCTGCGACCTCTTcctttgctgctgacgtgTGGAGTT
CCGTCAGCATGGACTTCGTATTCGGACTGCCCACCGATGCCAAGGGGCGTTCGGgcatcctcgtcctcgtcgacagattcagcaagatggtgcatctcgc
tccagttcctgccTCGGTCACAGCCGAGGANAGATGTGCTTCGCAGCTACGCCATGTCGTACACGTCCTGGAGCGAGTTCCTGCCCTTTACCGAATTCGC
ACTGAATAACCCAGTCTATGGGCTTGACTCCTTTCTTCGTGAATAACGCGCGCCATCCACGCGTTCCTGCCGTACTCGCCGTAGCTTCGTCCAcggctgc
ggctgcttgTAATTCTGGTGGGGGAAAGAcaccgacagcttcgacgtcgaaggCACCGACTGTTTCGGCGTCAAAAGGGGTTTCGGTTCAAGTGACAGCC
CAAACATCAACGTGCTGACAAAATGGGCCGCGGAGACGCTGGTCAACCCGACAGCCCCGACCCGGGCGATAGCCTTCCCGTGTCATGTGATCCGCGATAG
GCGCCGTGTCACCAGTGGCCAACTTCGAGACCAACGGGCTCCCAGCAGCgggtgacgctgctgcactctcCGACTTCCTGCTTCATCGGCAGTCGACTGT
ACGCTACGTGCGTGACGCCATAGCACTGGCAGTCGACAAGCAGAAAGCGAATGCAAACAAACGAGGTCGAAAGAACAAGGAGACGTTCAAGGTTGGTGAC
CGAGTGTTACTATCGGTCACGGGCATAGCGGCTAACGCCGTGACGAATCTGGGAATCAACCCGCTGCTTCCACGCTACATCGGTCAATTCAAAATTGCGG
ATGTACTCGGCGACGCCTACAC