Description :
From Genome Similarity Track
Location :
Scaffold_1127:9949- 11155
Transcript NameFunction/comments
Phyta_totarag12140hypothetical protein

Sequence
1206 bases(100 bases per row)
ttaaccctttcgcggTGTGAGAGCGCATTTTTCGTCTTTTAACCTTGTTATCAATTCACGGTGCAATATGACAATCTAAAGGGCGTATTATGCGCCATTT
TAGCTTCATTCCACTTCCCATCTACCGTGTTTTGTTACTACCAATAAGAACAGTGCACCTGCCAAGGCCTGGGGAAAATTTTGAGTGCTGCGCGCCGTCG
ACAGTTATTTATTGCATCGAAGCTGTAATCGGACATTGCCACGCCACCACCGTCACCCATAAAGTGGCCATAAACGGGATGAGATCTCGCTCTTGTTTCC
TGCCATTCATACTCCCTATAAAACGATAAGATGCATGCATCCAAAGTGATTTTTCATTACTCATCATACCAACGCCAAGCTAGATGCGTACAACGTTTAC
GGACTTCGAAGATAAAGTGCTCGTGCAGATTGCCTTCCAGTTCGAGAATGACGGCCTCCGTATTACCTGGGATTATGTCGCATGTCGTATGAAAACGAAG
CGCACAGTGCGCGAGCTCCGCCTGCGTTTAGCCAGCCTCAAGCGCACACACGGGAAGTCTATTCGAGGCTTCCCGCCGTGCTTCTTCGCTGGTCTCCGCA
CGAGACAGCTTTTAACAGCTTCAGGACTACCGCTACCGTCATCCCTCGTTCCCTAAAGACCACCGAGACTCTCCTTCTTAGCCACACCACCCAGCAGCCT
TGTACTATGACGCAACTTAGTTGGTGGCAGCGCAGCAAGTACAGCAGGTGCGTGAGCGTCGAGGTGCAAGCGGAGGTGGTGTACGTGACTGACGGtattg
ctgttcttgttgGTGTTTTGTAGGTGGCGTTGCTAGAGATGGCGGAGGTGATGGCAGTGTTTCTGTCGGTCTGGCAGTCGCACCTGGCCGTGATGGGCGA
GGCGCACGTGGCGGATATGCAACAATGCACAACTAACGACAAGCCATAGAGGTTATAAGTTCTATTTTTGGCAGAATAAGGACATAAAATGTTCGGCAAC
AAGCGGGGCATACGCATAATAATGCGGGGGAAGTTTTACCTGTTGGTGGTGCCACTGCAATCGAGGCCTTTGGACTGGTAGGAGACAACGATGTTTTTCT
CGATATTGGAGCTGGCGTTGGTAACATTCTTGCCCAAGGTGCACGTTCGACGGCGGTTAGTGCATGCATTGGTATCGAGGTCCGAAGGGACCTATGCTCG
CTTGGG