Description :
From Genome Similarity Track
Location :
Scaffold_65:99473- 104940
Sequence
5467 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTAACATAATTTTTC
AACAGGGGGGGGGGGGCAACTTGCACGGTCAGACTCAGTGACATCATGCTAGCGGATCCGACAGTTGTTGCTGCTCGTGATGATATCTTCTTATATATTG
TCACAGACACGATTCACACGCGACAGCAGTCTTCGGCACGACTTTACCTACGGCGTCGAGCAGCCGCAACACCAAGAATTCATCTGGAAGATCTGAATGT
TGGTGTCTAGGTACTAGATGTGGTGGAACAATAATGAAGAGCGGTCAGCGTACAACAGAGCGAGTATTGAGTGTGGCTACGGACAGGCTGGTCACGCAAA
GTGCACAATAGCAAACTAGCAAACTAGCAAGCTAGTAAGCTGAAGGCATCGGTAAGGAAGTAGTGAGGCAGGAGAGGCAAAAGAAGAGCCCCCAGGCGGG
ATCGAACCACCGACCTTTCGCTTACGAAGCGAGTGCTCTACCACTGAGCTATAGGGGCTTACGGACAAAGAGACACATTCACAGCACGAGCACCACATAC
ACCACAATAAAAGCATACGCACGAACATGCATACATCGCACTCACCGTCCATGCATACACCATACGTCAACTACTACATCACCGCCAACTCAGCGCATGC
CACATTGCCACATCAACTCCTTTCCTTAAAGCTGCTGCGACGCATCGGTAAGGGCTCCGCCACTTCAAACGACGCTTCGATGAGCGGAGATATGTGTGCG
AGGTGCTCGTGACGTGGTTTCGTCGTAGAAGTAAAGAAGGGTGAGATGTGGCGGGGTGAGTGGGTAGAAATTGTGGATCTTGTAATGCGTATCGGTGTGT
GGATGGAGTCTGCATGTGTGGACATTGGGTTTTGGTATCGGGGGAATAGCTCAGTGGTAGAGCGCTGGATTCCAGTCCCAGCGGTCGGGGGCTCGATCCC
CTCTTCCCTCATGCTTTAAGCTTTTGCGCGTCCTTCGTTTCTCTGTCCGTTTTCCCACCTTAACAGCCGCACAGTTACAATGCTCACTATCAGCCGAGCA
CACGACCACGCCACCAAGCAAAAAGTGCGATACTTCTCGATTTATGCGTGTCATCCTTGCGCAGGGGCCATGCTAAACTTCTCTGTATCGTTCCAATTTT
TACGGATGACCACCGAAGTGGTTCCTACCACACGCCTCGCGGCACCGACCCTCACATCCTGAACCACGTTCGCCGATAAGGGAAGGCTTTCGTGCCAAGG
CCGTGCATCACCCAGCAATTTTCAGACTAGCTTTTGCTACCGCGAGTCTGCTGAGGTAAAGGAAAACGACAGCTGTGAGATTCGAACTCACGCGGGTTGC
CCCATTAACTTAGCAGGCTAACGCCTTAACCACTCGGCCAAGCTGTCATCGTTATGCAACAAAAAACATAGATATCCACTCCCACCCTCATCAGATTCAA
ATCAACCAAACCAAACTCACGACCACCCCGCACATACCGTCACGACCTGTGCTACCACCCATAGATACAGCGCATACCGCACGCCTTTATCAAATACTGA
CAACACTAAGAGAGAACATCCACACTCGCCGGCAGCACAATCTTCAATCGTCAAAGCATTCAGCGTCTTTCACCTCTGCATGTCTTCGGCTGGTGGCATG
TTGGCCACCACCTACGTACGCTGCTTATGTTCTAACCCGCCACGGATATCATCTCGTACATAATACTCTCAACAGGGGGGGGGGGCAACTTGCACGGTCA
GACTCAGTGACATCATGCTAGCGGATCCGACAGTTGTTGCTGCTCGTGATGATATCTTCTTATATATTGTCACAGACACGATTCACACGCGACAGCAGTG
TTCGGCACGACTTTACCTACGGCGTCGAGCAGCCGCAACACCAAGAATTCATCTGGAAGATCTGAATGTTGGTGTCTAGGTACTAGATGTGGTGGAACAA
TAATGAAGAGCGGTCAGCGTACAACAGAGCGAGCATTGAGTGTGGCTACGGACAGGCTGGTCACGCAAAGTGCACAATAGCAAACTAGCAAACTAGCAAG
CTAGTAAGCTGAAGGCATCCGTAAGGAAGTAGTGAGGCAGGAGAGGCAAAAGAAGAGCCTCCAGGCGGGATCGAACCACCGACCTTTCGCTTACGAAGCG
AGTGCTCTACCACTGAGCTATAGGGGCTTACGGACTTCGACTCAAAGAGACACATTCACAGCACGAGCACCACATACACCACAATAAAAGCATACGCACG
AACATGCATACATCGCACTCACCGTCCATGCATACACCATACGTCAACTACTACATCACCGCCAACTCAGCGCATGCCACATTGCCACATCAACTCCTTT
CCTTAAAGCTGCTGCGACGCATCGGTAAGGGCTCCGCCACTTCAAACGACGCTTCGATGAGCGGAGAGATGTGTGCGAGGTGCTCGTGACGTGGTTTCGT
CGTAGAAGTAAAGAAGGGTGAGATGTGGTGGGGTGAGTGGGTAGAAATTGTGGATCTCGTAATGCGTATCGGTGTGTGAATGGAGTTTGCATGTTTGGAA
GTTGGGTTTTGGTATCGGGGGAATAGCTCAGTGGTAGAGCGCTGGATTCCAGTCCCAGCGGTCGGGGGATCGATCCCCTCTTCCCTCATGCTTTAAGCTT
TTGCGCGTCCTTCGTTTCTCTGTCCGTCTTCCCACCTTAACAGCCGCACGGTTACAATGCTCACCATCAGCCGAGCCCACGACCACGCCACCAAGCACAA
AGTGCGATACTTCTCGATTTATGCGTGTTCCTTCTGTGCAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTTACGGATGACCACCGAAGTGGTT
CCTACCACACGACCCGCGTCACCGACATATAGCTGCTAGCCTTGGGCCTCACATCCAGAACCACTTTCGTCGAAAAGGGAAGGACTACCAGCCCAGTCCA
TGCATCCACTAGCATTTTCAGATTAGTTTTTGCTACCGCGAGTCTGCTGAGGTAAAGGAAAACGACAGCTGTGAGATTCGAACTCACGCGGGTTGCCCCA
TTAACTTAGCAGGCTAACGCCTTAACCACTCGGCCAAGCTGTCATCGTTATGCAACAAAAAAACATAGATATCCACTCCCACCCTCATCAGATTCAAATC
AACCAAACCAAACCCACGACCACCCCGCACATACCGTCACGACCTGTGCTACCACCCATAGATACAGCGCATACCGCACGCCTTTATCAAATACTGACAA
CACTAAGAGAGAACATCCACACTCGCCGGCAGCACAATCTTTAATCGTCAAAGCATTCAGCGTCTTTCACCTCTGCATGTCTTCGGCTGGTGGCATGTTG
GCCACCACCTACGTACGCTGCTTATGTTCTAACCCGCCACGGATATCATCTCGTACATAATACTCTCAACAGGGGGGGGGGGGCAACTTGCACGGTCAGA
CTCAGTGACATCATGCTAGCGGATCCGACAGTTGTTGCTGCTCGTGATGATATCTTCTTATATATTGTCACAGACACGATTCACACGCGACAGCAGTCTT
CGGTACGACTTTACCTACGGCGTCGAGCAGCCGCAACACCAAGAATTCATCTGGAAGATCTGAATGTTGGTGTCTAGGTACTAGATGTGGTGGAACAATA
ATGAAGAGCGGTCAGCGTACAACAGAGCGAGCATTGAGTGTGGCTACGGACAGGCTGGTCACGCAAAGTGCACAATAGCAAACTAGCAAACTAGCAAGCT
AGTAAGCTGAAGGCATCGGTAAGGAAGTAGTGAGGCAGGAGAGGCAAAAGAAGAGCCCCCAGGCGGGATCGAACCACCGACCTTTCGCTTACGAAGCGAG
TGCTCTACCACTGAGCTATAGGGGCTTACGGACAAAGAGACACATTCACAGCACGAGCACCACATACACCACAATAAAAGCATACGCACGAACATGCATA
CATCGCACTCACCGTCCATGCATACACCATACGTCAACTACTACATCACCGCCAACTCAGCGCATGCCACATTGCCACATCAACTCCTTTCCTTAAAGCT
GCTGCGACGCATCGGTAAGGGCGCCGCCACTTCAAACGACGCTTCGATGAGCGGAGATATGTGTGCGAGGTGCTCGTGACGTGGTTTCGTCGTAGAAGTA
AAGAAGGGTGAGATGTGGCGGGGTGAGTGGGTAGAAATTGTGGATCTCGTAATGCGTATCGGTGTGTGGATGGAGTCTGCATGTGTGGACATTGGGTTTT
GGTATCGGGGGAATAGCTCAGTGGTAGAGCGCTGGATTCCAGTCCCAGCGGTCGGGGGCTCGATCCCCTCTTCCCTCATGCTCTAAGCTTTTGCGCGTCC
TTCGTTTCTCTGTCCGTTTTCCCACCTTAACAGCCGCACAGTTACAATGCTCACTATCAGCCGAGCACACGACCACGCCACCAAGCAAAAAGTGCGATAC
TTCTCGATTTATGCGTGTCATCCTTGCGCAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTTACGGATGACCACCGAAGTGGTTCCTACCACAC
GCCTCGCGTCACCGACATATAGCTGCTAGCCTTGGGCCTCACATCCAGAACCACTTTCGTCGAGAAGGGAAGGACTACCAGCCCAGTCCGTGCATCCACC
AGCATTTTCAGATTAGTTTTTGCTACTGCGAGTCTGCTGAGGTAAAGGAAAACGACAGCTGTGAGATTCGAACTCACGCGGGTTGCCCCATTAACTTAGC
AGGCTAACGCCTTAACCACTCGGCCAAGCTGTCATCGTTATGCAACAAAAAACATAGATATCCACTCCCACCCTCATCAGATTCAAATCAACCAAACCAA
ACTCACGACCACCCCCGCACATACCGTCACGACCTGTGCTACCACCCATAGATACAGCGCATACCGCACGCCTTTATCAAATACTGACAACACTAAGAGA
GAACATCCACACTCGCCGGCAGCACAATCTTCAATCGTCAAAGCATTCAGCGTCTTTCACCTCTGCA